Estrogen Related Receptor gamma (ESRRG) (NM_001243505) Human Untagged Clone
CAT#: SC330128
ESRRG (untagged) - Homo sapiens estrogen-related receptor gamma (ESRRG), transcript variant 6
"NM_001243505" in other vectors (2)
Product Images
Other products for "ESRRG"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ESRRG |
Synonyms | ERR-gamma; ERR3; ERRg; ERRgamma; NR3B3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243505, the custom clone sequence may differ by one or more nucleotides
ATGCCTGACCCTACTGTCCCCGACAGTGACATCAAAGCCCTCACTACACTGTGTGACTTGGCCGACCGAG AGTTGGTGGTTATCATTGGATGGGCGAAGCATATTCCAGGCTTCTCCACGCTGTCCCTGGCGGACCAGAT GAGCCTTCTGCAGAGTGCTTGGATGGAAATTTTGATCCTTGGTGTCGTATACCGGTCTCTTTCGTTTGAG GATGAACTTGTCTATGCAGACGATTATATAATGGACGAAGACCAGTCCAAATTAGCAGGCCTTCTTGATC TAAATAATGCTATCCTGCAGCTGGTAAAGAAATACAAGAGCATGAAGCTGGAAAAAGAAGAATTTGTCAC CCTCAAAGCTATAGCTCTTGCTAATTCAGACTCCATGCACATAGAAGATGTTGAAGCCGTTCAGAAGCTT CAGGATGTCTTACATGAAGCGCTGCAGGATTATGAAGCTGGCCAGCACATGGAAGACCCTCGTCGAGCTG GCAAGATGCTGATGACACTGCCACTCCTGAGGCAGACCTCTACCAAGGCCGTGCAGCATTTCTACAACAT CAAACTAGAAGGCAAAGTCCCAATGCACAAACTTTTTTTGGAAATGTTGGAGGCCAAGGTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243505 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243505.1, NP_001230434.1 |
RefSeq Size | 4776 bp |
RefSeq ORF | 624 bp |
Locus ID | 2104 |
Cytogenetics | 1q41 |
Protein Families | Druggable Genome, Nuclear Hormone Receptor, Transcription Factors |
Gene Summary | 'This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]' Transcript Variant: This variant (6) lacks three exons from the 5' end but has alternate three 5' exons and uses a downstream AUG start codon, compared to variant 1. The resulting isoform (3) is shorter at the N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.