LIM domain only 3 (LMO3) (NM_001243610) Human Untagged Clone

CAT#: SC330151

LMO3 (untagged) - Homo sapiens LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LMO3
• Synonyms: RBTN3; RBTNL2; Rhom-3; RHOM3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243610, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCTCAGTCCAGCCAGACACCAAGCCGAAAGGTTGTGCTGGCTGCAACCGAAAGATCAAGGACCGGT
  ATCTTCTAAAGGCACTGGACAAATACTGGCATGAAGACTGCCTGAAGTGTGCCTGCTGTGACTGTCGCTT
  GGGAGAGGTGGGCTCCACCCTGTACACTAAAGCTAATCTTATCCTTTGTCGCAGAGACTATCTGAGGCTC
  TTTGGTGTAACGGGAAACTGCGCTGCCTGTAGTAAGCTCATCCCTGCCTTTGAGATGGTGATGCGTGCCA
  AGGACAATGTTTACCACCTGGACTGCTTTGCATGTCAGCTTTGTAATCAGAGATTTTGTGTTGGAGACAA
  ATTTTTCCTAAAGAATAACATGATCCTTTGCCAGACGGACTACGAGGAAGGTTTAATGAAAGAAGGTTAT
  GCACCCCAGGTTCGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243610
• ORF Size: 438 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001243610.1, NP_001230539.1
• RefSeq Size: 3431
• RefSeq ORF: 438
• Locus ID: 55885
• Protein Families: Transcription Factors
• Gene Summary: The protein encoded by this gene belongs to the rhombotin family of cysteine-rich LIM domain oncogenes. This gene is predominantly expressed in the brain. Related family members, LMO1 and LMO2 on chromosome 11, have been reported to be involved in chromosomal translocations in T-cell leukemia. Many alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (4) differs at the 5' end compared to variant 1. Variants 1-4 encode the same isoform (1).