APH1A (NM_001243771) Human Untagged Clone

CAT#: SC330177

APH1A (untagged) - Homo sapiens APH1A gamma secretase subunit (APH1A), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: APH1A
• Synonyms: 6530402N02Rik; APH-1; APH-1A; CGI-78
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243771, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGGCTGCGGTGTTTTTCGGCTGCACTTTCGTCGCGTTCGGCCCGGCCTTCGCGCTTTTCTTGATCA
  CTGTGGCTGGGGACCCGCTTCGCGTTATCATCCTGGTCGCAGGGAAGGCAGATGAGGGGTTAGCATCGCT
  GAGTGAGGACGGAAGATCACCCATCTCCATCCGCCAGATGGCCTATGTTTCTGGTCTCTCCTTCGGTATC
  ATCAGTGGTGTCTTCTCTGTTATCAATATTTTGGCTGATGCACTTGGGCCAGGTGTGGTTGGGATCCATG
  GAGACTCACCCTATTACTTCCTGACTTCAGCCTTTCTGACAGCAGCCATTATCCTGCTCCATACCTTTTG
  GGGAGTTGTGTTCTTTGATGCCTGTGAGAGGAGACGGTACTGGGCTTTGGGCCTGGTGGTTGGGAGTCAC
  CTACTGACATCGGGACTGACATTCCTGAACCCCTGGTATGAGGCCAGCCTGCTGCCCATCTATGCAGTCA
  CTGTTTCCATGGGGCTCTGGGCCTTCATCACAGCTGGAGGGTCCCTCCGAAGTATTCAGCGCAGCCTCTT
  GTGTAAGGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243771
• ORF Size: 573 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001243771.1, NP_001230700.1
• RefSeq Size: 2119
• RefSeq ORF: 573
• Locus ID: 51107
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
• Protein Pathways: Alzheimer's disease, Notch signaling pathway
• Gene Summary: This gene encodes a component of the gamma secretase complex that cleaves integral membrane proteins such as Notch receptors and beta-amyloid precursor protein. The gamma secretase complex contains this gene product, or the paralogous anterior pharynx defective 1 homolog B (APH1B), along with the presenilin, nicastrin, and presenilin enhancer-2 proteins. The precise function of this seven-transmembrane-domain protein is unknown though it is suspected of facilitating the association of nicastrin and presenilin in the gamma secretase complex as well as interacting with substrates of the gamma secretase complex prior to their proteolytic processing. Polymorphisms in a promoter region of this gene have been associated with an increased risk for developing sporadic Alzheimer's disease. Alternative splicing results in multiple protein-coding and non-protein-coding transcript variants. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (3) lacks a 5' exon and contains an alternate segement at the 3'end that results in a frameshift and premature stop codon, compared to variant 1. This variant encodes an isoform (3) with a shorter N-terminus and a shorter and distinct C-terminus, compared to isoform 1.