HLA-DQB1 (NM_001243961) Human Untagged Clone

CAT#: SC330201

HLA (untagged) - Homo sapiens major histocompatibility complex, class II, DQ beta 1 (HLA-DQB1), transcript variant 2


  "NM_001243961" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HLA-DQB1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HLA-DQB1
Synonyms CELIAC1; HLA-DQB; IDDM1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243961, the custom clone sequence may differ by one or more nucleotides


ATGTCTTGGAAGAAGGCTTTGCGGATCCCCGGAGACCTTCGGGTAGCAACTGTCACCTTGATGCTGGCGA
TGCTGAGCTCCCTACTGGCTGAGGGCAGAGACTCTCCCGAGGATTTCGTGTTCCAGTTTAAGGGCATGTG
CTACTTCACCAACGGGACGGAGCGCGTGCGTCTTGTGACCAGATACATCTATAACCGAGAGGAGTACGCG
CGCTTCGACAGCGACGTGGGGGTGTACCGCGCGGTGACGCCGCAGGGGCGGCCTGATGCCGAGTACTGGA
ACAGCCAGAAGGAAGTCCTGGAGGGGACCCGGGCGGAGTTGGACACGGTGTGCAGACACAACTACGAGGT
GGCGTTCCGCGGGATCTTGCAGAGGAGAGTGGAGCCCACAGTGACCATCTCCCCATCCAGGACAGAGGCC
CTCAACCACCACAACCTGCTGGTCTGCTCGGTGACAGATTTCTATCCAGGCCAGATCAAAGTCCGGTGGT
TTCGGAATGATCAGGAGGAGACAGCCGGCGTTGTGTCCACCCCCCTTATTAGGAATGGTGACTGGACTTT
CCAGATCCTGGTGATGCTGGAAATGACTCCCCAGCGTGGAGATGTCTACACCTGCCACGTGGAGCACCCC
AGCCTCCAGAGCCCCATCACCGTGGAGTGGCGGGCTCAGTCTGAATCTGCCCAGAGCAAGATGCTGAGTG
GCGTTGGAGGCTTCGTGCTGGGGCTGATCTTCCTTGGGCTGGGCCTTATCATCCGTCAAAGGAGTCAGAA
AGGACCTCAAGGGCCTCCACCAGCAGGGCTTCTGCACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001243961
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243961.1, NP_001230890.1
RefSeq Size 1664 bp
RefSeq ORF 810 bp
Locus ID 3119
Cytogenetics 6p21.32
Protein Families Transmembrane
Protein Pathways Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis
Gene Summary 'HLA-DQB1 belongs to the HLA class II beta chain paralogs. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and it contains six exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]'
Transcript Variant: This variant (2) includes an alternate in-frame exon in the coding region, compared to variant 1. It encodes isoform 2 which is longer than isoform 1. This transcript represents the DQB1*06:02:01:01 allele of the HLA-DQB1 gene, as represented in the assembled chromosome 6 in the primary assembly of the reference genome. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.