DLST (NM_001244883) Human Untagged Clone

CAT#: SC330226

DLST (untagged) - Homo sapiens dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (DLST), transcript variant 2


  "NM_001244883" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DLST"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DLST
Synonyms DLTS
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001244883, the custom clone sequence may differ by one or more nucleotides


ATGCTGTCCCGATCCCGCTGTGTGTCTCGGGCGTTCAGCCGCTCGCTCTCCGCCTTCCAGAAGGGGAACT
GCCCTCTAGGGAGACGTTCCCTGCCTGGGGTCTCCTTATGCCAGGGACCAGGTTACCCTAACAGCAGGAA
GGTTGTCATTAACAACAGTGTCTTCAGTGTTCGCTTTTTCAGAACTACAGCTGTATGCAAGGATGACTTG
GTTACAGTCAAAACCCCAGCGTTTGCAGAATCTGTCACAGAGGGAGATGTCAGGTGGGAGAAAGCTGTTG
GAGACACAGTTGCAGAAGATGAAGTGGTTTGTGAGATTGAAACTGACAAGACATCTGTGCAGGTTCCATC
ACCAGCAAATGGCGTGATTGAAGCTCTTTTGGTACCTGATGGGGGAAAAGTCGAAGGAGGCACTCCACTT
TTCACACTCAGGAAAACTGGTGGTAAAGAAGTTCTCCTGGTGGTCAAGGTCTCCAGTGTTCCCTCTTGGG
ATTGGGACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001244883
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244883.1, NP_001231812.1
RefSeq Size 1229 bp
RefSeq ORF 501 bp
Locus ID 1743
Cytogenetics 14q24.3
Protein Pathways Citrate cycle (TCA cycle), Lysine degradation, Metabolic pathways
Gene Summary 'This gene encodes a mitochondrial protein that belongs to the 2-oxoacid dehydrogenase family. This protein is one of the three components (the E2 component) of the 2-oxoglutarate dehydrogenase complex that catalyzes the overall conversion of 2-oxoglutarate to succinyl-CoA and CO(2). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]'
Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a shorter isoform (2) with a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.