PP1C gamma (PPP1CC) (NM_001244974) Human Untagged Clone

CAT#: SC330239

PPP1CC (untagged) - Homo sapiens protein phosphatase 1, catalytic subunit, gamma isozyme (PPP1CC), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP1CC
• Synonyms: PP-1G; PP1C; PPP1G
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001244974, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGATTTAGATAAACTCAACATCGACAGCATTATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGC
  CTGGTAAGAATGTCCAGCTTCAGGAGAATGAAATCAGAGGACTGTGCTTAAAGTCTCGTGAAATCTTTCT
  CAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAAATATGTGGTGACATCCATGGACAATACTAT
  GATTTGCTGCGACTTTTTGAGTACGGTGGTTTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTATG
  TGGACAGGGGAAAGCAGTCATTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAAATATCCTGAGAA
  TTTTTTTCTTCTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAATTTATGGATTTTATGATGAATGT
  AAAAGAAGATACAACATTAAACTATGGAAAACTTTCACAGACTGTTTTAACTGTTTACCGATAGCAGCCA
  TCGTGGATGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCG
  GCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGAT
  AAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAA
  AATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATT
  TTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTGCGGAGAGTTTGACAATGCAGGT
  GCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAGAAAAAGAAGC
  CAAATGCCACGAGACCTGTAACGCCTCCAAGGGTTGCATCAGGCCTGAACCCGTCCATTCAGAAAGCTTC
  AAATTATAGAAACAATACTGTTCTATACGAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001244974
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001244974.1, NP_001231903.1
• RefSeq Size: 1626 bp
• RefSeq ORF: 1014 bp
• Locus ID: 5501
• Cytogenetics: 12q24.11
• Protein Families: Druggable Genome, Phosphatase
• Protein Pathways: Focal adhesion, Insulin signaling pathway, Long-term potentiation, Oocyte meiosis, Regulation of actin cytoskeleton, Vascular smooth muscle contraction
• Gene Summary: 'The protein encoded by this gene belongs to the protein phosphatase family, PP1 subfamily. PP1 is an ubiquitous serine/threonine phosphatase that regulates many cellular processes, including cell division. It is expressed in mammalian cells as three closely related isoforms, alpha, beta/delta and gamma, which have distinct localization patterns. This gene encodes the gamma isozyme. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]'
  Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a longer isoform (2) with a distinct C-terminus compared to isoform 1.