p53 AIP1 (TP53AIP1) (NM_001251964) Human Untagged Clone
CAT#: SC330250
TP53AIP1 (untagged) - Homo sapiens tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 4
"NM_001251964" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TP53AIP1 |
Synonyms | P53AIP1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001251964, the custom clone sequence may differ by one or more nucleotides
ATGGGATCTTCCTCTGAGGCGAGCTTCAGATCTGCTCAAGCTTCCTGCAGTGGGGCCAGGAGGCAGGGCC TGGGCAGGGGAGACCAGAACCTCTCGGTGATGCCTCCGAATGGCAGGGCTCAGACACACACACCTGGCTG GGTAAGTCCCTGCAGTGAAAACCGAGACGGTCTTTTGCCTGCCACAGCCCCGGGCAGACTCTGCTCTCAC CGTGGTGCCGACATCCCAAGTTTTCAGACTCACCAGGACCCAGTGACAGCATCTGGGTCCTCAGAGCTGC ATGCGGACTGTCCCCAGTTCAGAGCATTGGACAGAGCTGGGAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001251964 |
ORF Size | 327 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001251964.1, NP_001238893.1 |
RefSeq Size | 3158 |
RefSeq ORF | 327 |
Locus ID | 63970 |
Protein Families | Druggable Genome |
Protein Pathways | p53 signaling pathway |
Gene Summary | This gene is specifically expressed in the thymus, and encodes a protein that is localized to the mitochondrion. The expression of this gene is inducible by p53, and it is thought to play an important role in mediating p53-dependent apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (4, also known as gamma) differs at the 3' end compared to variant 1, and encodes a shorter isoform (d) with a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231654 | TP53AIP1 (Myc-DDK tagged) - Homo sapiens tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 4 |
USD 420.00 |
|
RG231654 | TP53AIP1 (GFP-tagged) - Homo sapiens tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 4 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review