MRAS (NM_001252092) Human Untagged Clone
CAT#: SC330271
MRAS (untagged) - Homo sapiens muscle RAS oncogene homolog (MRAS), transcript variant 5
"NM_001252092" in other vectors (2)
Product Images
Other products for "MRAS"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MRAS |
Synonyms | M-RAs; R-RAS3; RRAS3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001252092, the custom clone sequence may differ by one or more nucleotides
ATGCGGGAGCAATACATGCGCACGGGGGATGGCTTCCTCATCGTCTACTCCGTCACTGACAAGGCCAGCT TTGAGCACGTGGACCGCTTCCACCAGCTTATCCTGCGCGTCAAAGACAGGGAGTCATTCCCGATGATCCT CGTGGCCAACAAGGTCGATTTGATGCACTTGAGGAAGATCACCAGGGAGCAAGGAAAAGAAATGGCGACC AAACACAATATTCCGTACATAGAAACCAGTGCCAAGGACCCACCTCTCAATGTCGACAAAGCCTTCCATG ACCTCGTTAGAGTAATTAGGCAACAGATTCCGGAAAAAAGCCAGAAGAAGAAGAAGAAAACCAAATGGCG GGGAGACCGGGCCACAGGCACCCACAAACTGCAATGTGTGATCTTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252092 |
ORF Size | 399 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001252092.1, NP_001239021.1 |
RefSeq Size | 3903 |
RefSeq ORF | 399 |
Locus ID | 22808 |
Protein Families | Druggable Genome |
Protein Pathways | MAPK signaling pathway, Regulation of actin cytoskeleton, Tight junction |
Gene Summary | This gene encodes a member of the Ras family of small GTPases. These membrane-associated proteins function as signal transducers in multiple processes including cell growth and differentiation, and dysregulation of Ras signaling has been associated with many types of cancer. The encoded protein may play a role in the tumor necrosis factor-alpha and MAP kinase signaling pathways. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (5) differs in the 5' UTR, lacks an exon and uses a downstream, in-frame start codon, compared to variant 1. Variants 4, 5 and 6 encode the same isoform (2), which has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.