MRAS (NM_001252092) Human Untagged Clone

CAT#: SC330271

MRAS (untagged) - Homo sapiens muscle RAS oncogene homolog (MRAS), transcript variant 5


  "NM_001252092" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MRAS"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MRAS
Synonyms M-RAs; R-RAS3; RRAS3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001252092, the custom clone sequence may differ by one or more nucleotides


ATGCGGGAGCAATACATGCGCACGGGGGATGGCTTCCTCATCGTCTACTCCGTCACTGACAAGGCCAGCT
TTGAGCACGTGGACCGCTTCCACCAGCTTATCCTGCGCGTCAAAGACAGGGAGTCATTCCCGATGATCCT
CGTGGCCAACAAGGTCGATTTGATGCACTTGAGGAAGATCACCAGGGAGCAAGGAAAAGAAATGGCGACC
AAACACAATATTCCGTACATAGAAACCAGTGCCAAGGACCCACCTCTCAATGTCGACAAAGCCTTCCATG
ACCTCGTTAGAGTAATTAGGCAACAGATTCCGGAAAAAAGCCAGAAGAAGAAGAAGAAAACCAAATGGCG
GGGAGACCGGGCCACAGGCACCCACAAACTGCAATGTGTGATCTTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001252092
ORF Size 399 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001252092.1, NP_001239021.1
RefSeq Size 3903
RefSeq ORF 399
Locus ID 22808
Protein Families Druggable Genome
Protein Pathways MAPK signaling pathway, Regulation of actin cytoskeleton, Tight junction
Gene Summary This gene encodes a member of the Ras family of small GTPases. These membrane-associated proteins function as signal transducers in multiple processes including cell growth and differentiation, and dysregulation of Ras signaling has been associated with many types of cancer. The encoded protein may play a role in the tumor necrosis factor-alpha and MAP kinase signaling pathways. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks an exon and uses a downstream, in-frame start codon, compared to variant 1. Variants 4, 5 and 6 encode the same isoform (2), which has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.