MRAS (NM_001252093) Human Untagged Clone

CAT#: SC330272

MRAS (untagged) - Homo sapiens muscle RAS oncogene homolog (MRAS), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MRAS
• Synonyms: M-RAs; R-RAS3; RRAS3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001252093, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGGGAGCAATACATGCGCACGGGGGATGGCTTCCTCATCGTCTACTCCGTCACTGACAAGGCCAGCT
  TTGAGCACGTGGACCGCTTCCACCAGCTTATCCTGCGCGTCAAAGACAGGGAGTCATTCCCGATGATCCT
  CGTGGCCAACAAGGTCGATTTGATGCACTTGAGGAAGATCACCAGGGAGCAAGGAAAAGAAATGGCGACC
  AAACACAATATTCCGTACATAGAAACCAGTGCCAAGGACCCACCTCTCAATGTCGACAAAGCCTTCCATG
  ACCTCGTTAGAGTAATTAGGCAACAGATTCCGGAAAAAAGCCAGAAGAAGAAGAAGAAAACCAAATGGCG
  GGGAGACCGGGCCACAGGCACCCACAAACTGCAATGTGTGATCTTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252093
• ORF Size: 399 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001252093.1, NP_001239022.1
• RefSeq Size: 3822
• RefSeq ORF: 399
• Locus ID: 22808
• Protein Families: Druggable Genome
• Protein Pathways: MAPK signaling pathway, Regulation of actin cytoskeleton, Tight junction
• Gene Summary: This gene encodes a member of the Ras family of small GTPases. These membrane-associated proteins function as signal transducers in multiple processes including cell growth and differentiation, and dysregulation of Ras signaling has been associated with many types of cancer. The encoded protein may play a role in the tumor necrosis factor-alpha and MAP kinase signaling pathways. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
  Transcript Variant: This variant (6) differs in the 5' UTR, lacks an exon and uses a downstream, in-frame start codon, compared to variant 1. Variants 4, 5 and 6 encode the same isoform (2), which has a shorter N-terminus compared to isoform 1.