ST3GAL4 (NM_001254758) Human Untagged Clone

CAT#: SC330332

ST3GAL4 (untagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4), transcript variant 3


  "NM_001254758" in other vectors (2)

Reconstitution Protocol

USD 340.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ST3GAL4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ST3GAL4
Synonyms CGS23; gal-NAc6S; NANTA3; SAT3; SIAT4; SIAT4C; ST-4; ST3GalA.2; ST3GalIV; STZ
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001254758, the custom clone sequence may differ by one or more nucleotides


ATGGTCAGCAAGTCCCGCTGGAAGCTCCTGGCCATGTTGGCTCTGGTCCTGGTCGTCATGGTGTGGTATT
CCATCTCCCGGGAAGACAGGTACATCGAGCTTTTTTATTTTCCCATCCCAGAGAAGAAGGAGCCGTGCCT
CCAGGGTGAGGCAGAGAGCAAGGCCTCTAAGCTCTTTGGCAACTACTCCCGGGATCAGCCCATCTTCCTG
CGGCTTGAGGATTATTTCTGGGTCAAGACGCCATCTGCTTACGAGCTGCCCTATGGGACCAAGGGGAGTG
AGGATCTGCTCCTCCGGGTGCTAGCCATCACCAGCTCCTCCATCCCCAAGAACATCCAGAGCCTCAGGTG
CCGCCGCTGTGTGGTCGTGGGGAACGGGCACCGGCTGCGGAACAGCTCACTGGGAGATGCCATCAACAAG
TACGATGTGGTCATCAGATTGAACAATGCCCCAGTGGCTGGCTATGAGGGTGACGTGGGCTCCAAGACCA
CCATGCGTCTCTTCTACCCTGAATCTGCCCACTTCGACCCCAAAGTAGAAAACAACCCAGACACACTCCT
CGTCCTGGTAGCTTTCAAGGCAATGGACTTCCACTGGATTGAGACCATCCTGAGTGATAAGAAGCGGGTG
CGAAAGGGTTTCTGGAAACAGCCTCCCCTCATCTGGGATGTCAATCCTAAACAGATTCGGATTCTCAACC
CCTTCTTCATGGAGATTGCAGCTGACAAACTGCTGAGCCTGCCAATGCAACAGCCACGGAAGATTAAGCA
GAAGCCCACCACGGGCCTGTTGGCCATCACGCTGGCCCTCCACCTCTGTGACTTGGTGCACATTGCCGGC
TTTGGCTACCCAGACGCCTACAACAAGAAGCAGACCATTCACTACTATGAGCAGATCACGCTCAAGTCCA
TGGCGGGGTCAGGCCATAATGTCTCCCAAGAGGCCCTGGCCATTAAGCGGATGCTGGAGATGGGAGCTAT
CAAGAACCTCACGTCCTTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001254758
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001254758.1, NP_001241687.1
RefSeq Size 1727 bp
RefSeq ORF 1002 bp
Locus ID 6484
Cytogenetics 11q24.2
Protein Families Secreted Protein, Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
Gene Summary 'This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]'
Transcript Variant: This variant (3), as well as variants 2 and 8, encodes isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.