ST3GAL4 (NM_001254759) Human Untagged Clone
CAT#: SC330333
ST3GAL4 (untagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4), transcript variant 4
"NM_001254759" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ST3GAL4 |
Synonyms | CGS23; gal-NAc6S; NANTA3; SAT3; SIAT4; SIAT4C; ST-4; ST3GalA.2; ST3GalIV; STZ |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001254759, the custom clone sequence may differ by one or more nucleotides
ATGTGTCCTGCAGGCTGGAAGCTCCTGGCCATGTTGGCTCTGGTCCTGGTCGTCATGGTGTGGTATTCCA TCTCCCGGGAAGACAGGTACATCGAGCTTTTTTATTTTCCCATCCCAGAGAAGAAGGAGCCGTGCCTCCA GGGTGAGGCAGAGAGCAAGGCCTCTAAGCTCTTTGGCAACTACTCCCGGGATCAGCCCATCTTCCTGCGG CTTGAGGATTATTTCTGGGTCAAGACGCCATCTGCTTACGAGCTGCCCTATGGGACCAAGGGGAGTGAGG ATCTGCTCCTCCGGGTGCTAGCCATCACCAGCTCCTCCATCCCCAAGAACATCCAGAGCCTCAGGTGCCG CCGCTGTGTGGTCGTGGGGAACGGGCACCGGCTGCGGAACAGCTCACTGGGAGATGCCATCAACAAGTAC GATGTGGTCATCAGATTGAACAATGCCCCAGTGGCTGGCTATGAGGGTGACGTGGGCTCCAAGACCACCA TGCGTCTCTTCTACCCTGAATCTGCCCACTTCGACCCCAAAGTAGAAAACAACCCAGACACACTCCTCGT CCTGGTAGCTTTCAAGGCAATGGACTTCCACTGGATTGAGACCATCCTGAGTGATAAGAAGCGGGTGCGA AAGGGTTTCTGGAAACAGCCTCCCCTCATCTGGGATGTCAATCCTAAACAGATTCGGATTCTCAACCCCT TCTTCATGGAGATTGCAGCTGACAAACTGCTGAGCCTGCCAATGCAACAGCCACGGAAGATTAAGCAGAA GCCCACCACGGGCCTGTTGGCCATCACGCTGGCCCTCCACCTCTGTGACTTGGTGCACATTGCCGGCTTT GGCTACCCAGACGCCTACAACAAGAAGCAGACCATTCACTACTATGAGCAGATCACGCTCAAGTCCATGG CGGGGTCAGGCCATAATGTCTCCCAAGAGGCCCTGGCCATTAAGCGGATGCTGGAGATGGGAGCTATCAA GAACCTCACGTCCTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001254759 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001254759.1, NP_001241688.1 |
RefSeq Size | 1871 bp |
RefSeq ORF | 999 bp |
Locus ID | 6484 |
Cytogenetics | 11q24.2 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways |
Gene Summary | 'This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]' Transcript Variant: This variant (4) encodes isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232502 | ST3GAL4 (Myc-DDK tagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4), transcript variant 4 |
USD 420.00 |
|
RG232502 | ST3GAL4 (GFP-tagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4), transcript variant 4 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review