COLEC11 (NM_001255989) Human Untagged Clone
CAT#: SC330342
COLEC11 (untagged) - Homo sapiens collectin sub-family member 11 (COLEC11), transcript variant 10
"NM_001255989" in other vectors (2)
Product Images
Other products for "COLEC11"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | COLEC11 |
Synonyms | 3MC2; CL-K1-I; CL-K1-II; CL-K1-IIa; CL-K1-IIb; CLK1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001255989, the custom clone sequence may differ by one or more nucleotides
ATGTGGTGGGTGCCTCCGAGTCCCTACGGTTGTCTTCCCTGCGCCCTGCCAGGTGAGAAAGGAGATTCCG GTGACATAGGACCCCCTGGTCCTAATGGAGAACCAGGCCTCCCATGTGAGTGCAGCCAGCTGCGCAAGGC CATCGGGGAGATGGACAACCAGGTCTCTCAGCTGACCAGCGAGCTCAAGTTCATCAAGAATGCTGTCGCC GGTGTGCGCGAGACGGAGAGCAAGATCTACCTGCTGGTGAAGGAGGAGAAGCGCTACGCGGACGCCCAGC TGTCCTGCCAGGGCCGCGGGGGCACGCTGAGCATGCCCAAGGACGAGGCTGCCAATGGCCTGATGGCCGC ATACCTGGCGCAAGCCGGCCTGGCCCGTGTCTTCATCGGCATCAACGACCTGGAGAAGGAGGGCGCCTTC GTGTACTCTGACCACTCCCCCATGCGGACCTTCAACAAGTGGCGCAGCGGTGAGCCCAACAATGCCTACG ACGAGGAGGACTGCGTGGAGATGGTGGCCTCGGGCGGCTGGAACGACGTGGCCTGCCACACCACCATGTA CTTCATGTGTGAGTTTGACAAGGAGAACATGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001255989 |
ORF Size | 594 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001255989.1, NP_001242918.1 |
RefSeq Size | 1260 |
RefSeq ORF | 594 |
Locus ID | 78989 |
Gene Summary | This gene encodes a member of the collectin family of C-type lectins that possess collagen-like sequences and carbohydrate recognition domains. Collectins are secreted proteins that play important roles in the innate immune system by binding to carbohydrate antigens on microorganisms, facilitating their recognition and removal. The encoded protein binds to multiple sugars with a preference for fucose and mannose. Mutations in this gene are a cause of 3MC syndrome-2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (10) differs in the 5' UTR, initiates translation at an alternate start codon, and lacks two consecutive exons in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (j) is shorter and has a distinct N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.