Apolipoprotein M (APOM) (NM_001256169) Human Untagged Clone

CAT#: SC330378

APOM (untagged) - Homo sapiens apolipoprotein M (APOM), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: APOM
• Synonyms: apo-M; G3a; HSPC336; NG20
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256169, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGCTGGCTCTGCCCCGATGCAGCTCCACCTTCGTGCTACCATCCGCATGAAAGATGGGCTCTGTG
  TGCCCCGGAAATGGATCTACCACCTGACTGAAGGGAGCACAGATCTCAGAACTGAAGGCCGCCCTGACAT
  GAAGACTGAGCTCTTTTCCAGCTCATGCCCAGGTGGAATCATGCTGAATGAGACAGGCCAGGGTTACCAG
  CGCTTTCTCCTCTACAATCGCTCACCACATCCTCCCGAAAAGTGTGTGGAGGAATTCAAGTCCCTGACTT
  CCTGCCTGGACTCCAAAGCCTTCTTATTGACTCCTAGGAATCAAGAGGCCTGTGAGCTGTCCAATAACTG
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256169
• ORF Size: 351 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256169.1, NP_001243098.1
• RefSeq Size: 722
• RefSeq ORF: 351
• Locus ID: 55937
• Protein Families: Secreted Protein
• Gene Summary: The protein encoded by this gene is an apolipoprotein and member of the lipocalin protein family. It is found associated with high density lipoproteins and to a lesser extent with low density lipoproteins and triglyceride-rich lipoproteins. The encoded protein is secreted through the plasma membrane but remains membrane-bound, where it is involved in lipid transport. Alternate splicing results in both coding and non-coding variants of this gene. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.