A RAF (ARAF) (NM_001256197) Human Untagged Clone

CAT#: SC330383

ARAF (untagged) - Homo sapiens v-raf murine sarcoma 3611 viral oncogene homolog (ARAF), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ARAF
• Synonyms: A-RAF; ARAF1; PKS2; RAFA1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256197, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCCACCACGGGGCCCCCCTGCCAATGGGGCCGAGCCATCCCGGGCAGTGGGCACCGTCAAAGTAT
  ACCTGCCCAACAAGCAACGCACGGTGGTGACTGTCCGGGATGGCATGAGTGTCTACGACTCTCTAGACAA
  GGCCCTGAAGGTGCGGGGTCTAAATCAGGACTGCTGTGTGGTCTACCGACTCATCAAGGGACGAAAGACG
  GTCACTGCCTGGGACACAGCCATTGCTCCCCTGGATGGCGAGGAGCTCATTGTCGAGGTCCTTGAAGATG
  TCCCGCTGACCATGCACAATTTTGTACGGAAGACCTTCTTCAGCCTGGCGTTCTGTGACTTCTGCCTTAA
  GTTTCTGTTCCATGGCTTCCGTTGCCAAACCTGTGGCTACAAGTTCCACCAGCATTGTTCCTCCAAGGTC
  CCCACAGTCTGTGTTGACATGAGTACCAACCGCCAACAGTTCTACCACAGTGTCCAGGATTTGTCCGGAG
  GCTCCAGACAGCATGAGGCTCCCTCGAACCGCCCCCTGAATGAGTTGCTAACCCCCCAGGGTCCCAGGTA
  G
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256197
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256197.1, NP_001243126.1
• RefSeq Size: 1408 bp
• RefSeq ORF: 561 bp
• Locus ID: 369
• Cytogenetics: Xp11.3
• Protein Families: Druggable Genome, Protein Kinase
• Protein Pathways: Acute myeloid leukemia, Bladder cancer, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Glioma, Insulin signaling pathway, Long-term depression, Long-term potentiation, Melanoma, Natural killer cell mediated cytotoxicity, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, Vascular smooth muscle contraction
• Gene Summary: 'This proto-oncogene belongs to the RAF subfamily of the Ser/Thr protein kinase family, and maybe involved in cell growth and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2012]'
  Transcript Variant: This variant (3) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in an immediate translation termination and a novel 3' UTR compared to variant 1. The resulting isoform (3) has a shorter C-terminus, compared to isoform 1.