A RAF (ARAF) (NM_001256197) Human Untagged Clone

CAT#: SC330383

ARAF (untagged) - Homo sapiens v-raf murine sarcoma 3611 viral oncogene homolog (ARAF), transcript variant 3


  "NM_001256197" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARAF"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARAF
Synonyms A-RAF; ARAF1; PKS2; RAFA1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256197, the custom clone sequence may differ by one or more nucleotides


ATGGAGCCACCACGGGGCCCCCCTGCCAATGGGGCCGAGCCATCCCGGGCAGTGGGCACCGTCAAAGTAT
ACCTGCCCAACAAGCAACGCACGGTGGTGACTGTCCGGGATGGCATGAGTGTCTACGACTCTCTAGACAA
GGCCCTGAAGGTGCGGGGTCTAAATCAGGACTGCTGTGTGGTCTACCGACTCATCAAGGGACGAAAGACG
GTCACTGCCTGGGACACAGCCATTGCTCCCCTGGATGGCGAGGAGCTCATTGTCGAGGTCCTTGAAGATG
TCCCGCTGACCATGCACAATTTTGTACGGAAGACCTTCTTCAGCCTGGCGTTCTGTGACTTCTGCCTTAA
GTTTCTGTTCCATGGCTTCCGTTGCCAAACCTGTGGCTACAAGTTCCACCAGCATTGTTCCTCCAAGGTC
CCCACAGTCTGTGTTGACATGAGTACCAACCGCCAACAGTTCTACCACAGTGTCCAGGATTTGTCCGGAG
GCTCCAGACAGCATGAGGCTCCCTCGAACCGCCCCCTGAATGAGTTGCTAACCCCCCAGGGTCCCAGGTA
G


Restriction Sites SgfI-MluI     
ACCN NM_001256197
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256197.1, NP_001243126.1
RefSeq Size 1408 bp
RefSeq ORF 561 bp
Locus ID 369
Cytogenetics Xp11.3
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Acute myeloid leukemia, Bladder cancer, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Glioma, Insulin signaling pathway, Long-term depression, Long-term potentiation, Melanoma, Natural killer cell mediated cytotoxicity, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, Vascular smooth muscle contraction
Gene Summary 'This proto-oncogene belongs to the RAF subfamily of the Ser/Thr protein kinase family, and maybe involved in cell growth and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2012]'
Transcript Variant: This variant (3) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in an immediate translation termination and a novel 3' UTR compared to variant 1. The resulting isoform (3) has a shorter C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.