UBE2L3 (NM_001256356) Human Untagged Clone
CAT#: SC330400
UBE2L3 (untagged) - Homo sapiens ubiquitin-conjugating enzyme E2L 3 (UBE2L3), transcript variant 3
"NM_001256356" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "UBE2L3"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UBE2L3 |
Synonyms | E2-F1; L-UBC; UBCH7; UbcM4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256356, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCCAGCAGGAGGCTGATGAAGGACAACCCTCCATATGATAAGGGAGCCTTCAGAATCGAAATCA ACTTTCCAGCAGAGTACCCATTCAAACCACCGAAGATCACATTTAAAACAAAGATCTATCACCCAAACAT CGACGAAAAGGGGCAGGTCTGTCTGCCAGTAATTAGTGCCGAAAACTGGAAGCCAGCAACCAAAACCGAC CAAGTAATCCAGTCCCTCATAGCACTGGTGAATGACCCCCAGCCTGAGCACCCGCTTCGGGCTGACCTAG CTGAAGAATACTCTAAGGACCGTAAAAAATTCTGTAAGAATGCTGAAGAGTTTACAAAGAAATATGGGGA AAAGCGACCTGTGGACTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256356 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001256356.1, NP_001243285.1 |
RefSeq Size | 2932 bp |
RefSeq ORF | 369 bp |
Locus ID | 7332 |
Cytogenetics | 22q11.21 |
Protein Pathways | Parkinson's disease, Ubiquitin mediated proteolysis |
Gene Summary | 'The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is demonstrated to participate in the ubiquitination of p53, c-Fos, and the NF-kB precursor p105 in vitro. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]' Transcript Variant: This variant (3) uses an alternate 5' splice site, lacks an alternate exon, and initiates translation from a downstream start site, compared to variant 4. It encodes a shorter and distinct N-terminus in isoform 3, compared to isoform 4. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.