UBE2L3 (NM_001256356) Human Untagged Clone

CAT#: SC330400

UBE2L3 (untagged) - Homo sapiens ubiquitin-conjugating enzyme E2L 3 (UBE2L3), transcript variant 3


  "NM_001256356" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "UBE2L3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UBE2L3
Synonyms E2-F1; L-UBC; UBCH7; UbcM4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256356, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCCAGCAGGAGGCTGATGAAGGACAACCCTCCATATGATAAGGGAGCCTTCAGAATCGAAATCA
ACTTTCCAGCAGAGTACCCATTCAAACCACCGAAGATCACATTTAAAACAAAGATCTATCACCCAAACAT
CGACGAAAAGGGGCAGGTCTGTCTGCCAGTAATTAGTGCCGAAAACTGGAAGCCAGCAACCAAAACCGAC
CAAGTAATCCAGTCCCTCATAGCACTGGTGAATGACCCCCAGCCTGAGCACCCGCTTCGGGCTGACCTAG
CTGAAGAATACTCTAAGGACCGTAAAAAATTCTGTAAGAATGCTGAAGAGTTTACAAAGAAATATGGGGA
AAAGCGACCTGTGGACTAA


Restriction Sites SgfI-MluI     
ACCN NM_001256356
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256356.1, NP_001243285.1
RefSeq Size 2932 bp
RefSeq ORF 369 bp
Locus ID 7332
Cytogenetics 22q11.21
Protein Pathways Parkinson's disease, Ubiquitin mediated proteolysis
Gene Summary 'The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is demonstrated to participate in the ubiquitination of p53, c-Fos, and the NF-kB precursor p105 in vitro. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]'
Transcript Variant: This variant (3) uses an alternate 5' splice site, lacks an alternate exon, and initiates translation from a downstream start site, compared to variant 4. It encodes a shorter and distinct N-terminus in isoform 3, compared to isoform 4.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.