PDLIM5 (NM_001256429) Human Untagged Clone

CAT#: SC330427

PDLIM5 (untagged) - Homo sapiens PDZ and LIM domain 5 (PDLIM5), transcript variant 9

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PDLIM5
• Synonyms: ENH; ENH1; L9; LIM
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256429, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCAACTACAGTGTGTCACTGGTTGGCCCAGCTCCTTGGGGTTTCCGGCTGCAGGGCGGTAAGGATT
  TCAACATGCCTCTGACAATCTCTAGTGCTGGAGTGCAGTGGCGCAATCTCGGCTCACCACAACCTCCATC
  TCCCGAGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGCATGTGCCACCACGC
  CTGGCTAATTTTGTATTTTTAGTAGAGACCAAGTTTCCCTATGTTGGTCAGGCTGGTCTTGAACTCCCGA
  CCTCAGGTGATCTGCCCACCTCGGCCTCCCAAAGTGCTAAGATTACAGGCGTGAGCCACCGTGCCTGGCC
  CACACTGTTTTATACTTTGCTTTTTTTTGCAACAATTTACCCTGAGATCATTCTCTATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256429
• ORF Size: 411 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256429.1, NP_001243358.1
• RefSeq Size: 1223
• RefSeq ORF: 411
• Locus ID: 10611
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of a family of proteins that possess a 100-amino acid PDZ domain at the N terminus and one to three LIM domains at the C-terminus. This family member functions as a scaffold protein that tethers protein kinases to the Z-disk in striated muscles. It is thought to function in cardiomyocyte expansion and in restraining postsynaptic growth of excitatory synapses. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (9) lacks several central and 3' exons but contains an alternate 3' exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (i) has the same N-terminus but has a distinct and significantly shorter C-terminus, compared to isoform a.