CHRNB4 (NM_001256567) Human Untagged Clone

CAT#: SC330456

CHRNB4 (untagged) - Homo sapiens cholinergic receptor, nicotinic, beta 4 (neuronal) (CHRNB4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHRNB4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256567, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGGCGCGCGCCTTCCCTGGTCCTTTTCTTCCTGGTCGCCCTTTGCGGGCGCGGGAACTGCCGCGTGG
  CCAATGCGGAGGAAAAGCTGATGGACGACCTTCTGAACAAAACCCGTTACAATAACCTGATCCGCCCAGC
  CACCAGCTCCTCACAGCTCATCTCCATCAAGCTGCAGCTCTCCCTGGCCCAGCTTATCAGCGTGAATGAG
  CGAGAGCAGATCATGACCACCAATGTCTGGCTGAAACAGGAATGGACTGATTACCGCCTGACCTGGAACA
  GCTCCCGCTACGAGGGTGTGAACATCCTGAGGATCCCTGCAAAGCGCATCTGGTTGCCTGACATCGTGCT
  TTACAACAAGTCGTTGAGGACTGGAAGTACGTGGCTATGGTGGTGGACCGGCTGTTCCTGTGGGTGTTCA
  TGTTTGTGTGCGTCCTGGGCACTGTGGGGCTCTTCCTACCGCCCCTCTTCCAGACCCATGCAGCTTCTGA
  GGGGCCCTACGCTGCCCAGCGTGACTGAGGGCCCCCTGGGTTGTGGGGTGAGAGGATGTGAGTGGCCGGG
  TGGGCACTTTGCTGCTTCTTTCTGGGTTGTGGCTGATGAGGCCCTAAGTAAATATGTGAGCATTGGCCAT
  CAACCCCATCAAACCAGCCACAGCCGTGGAACAGGCAAGGATGGGGGCCTGGGCTGTCCTCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256567
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256567.1, NP_001243496.1
• RefSeq Size: 1469 bp
• RefSeq ORF: 696 bp
• Locus ID: 1143
• Cytogenetics: 15q25.1
• Protein Families: Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
• Gene Summary: 'This gene is found within a conserved gene cluster and encodes one of the beta subunits of the nicotinic acetylcholine receptor (nAChRs) superfamily which form ligand-gated ion channels with a central pore that forms a cation channel. Neuronal nAChRs are pentameric structures that can be either homomeric or heteromeric, with heteromeric structures containing both alpha and beta subunits. Each subunit contains an extracellular amino terminus and four transmembrane domains. Nicotine is one of the agonists that binds to the receptor. Variants in this gene have been associated with nicotine dependence and lung cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2017]'
  Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2) with a distinct C-terminus, compared to isoform 1.