GDAP1L1 (NM_001256738) Human Untagged Clone

CAT#: SC330510

GDAP1L1 (untagged) - Homo sapiens ganglioside induced differentiation associated protein 1-like 1 (GDAP1L1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GDAP1L1
• Synonyms: dJ881L22.1; dJ995J12.1.1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256738, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGGCTCAACCTGGGCGAGGAGGTGCCCGTCATCATCCACCGCGACAACATCATCAGTGACTATGACC
  AGATCATTGACTATGTGGAGCGCACCTTCACAGGAGAGCACGTGGTGGCCCTGATGCCCGAGGTGGGCAG
  CCTGCAGCACGCACGGGTGCTGCAGTACCGGGAGCTGCTGGACGCACTGCCCATGGATGCCTACACGCAT
  GGCTGCATCCTGCATCCCGAGCTCACCACCGACTCCATGATCCCCAAGTACGCCACGGCCGAGATCCGCA
  GACATTTAGCCAATGCCACCACGGACCTCATGAAACTGGACCATGAAGAGGAGCCCCAGCTCTCCGAGCC
  CTACCTTTCTAAACAAAAGAAGCTCATGGCCAAGATCTTGGAGCATGATGATGTGAGCTACCTGAAGAAG
  ATCCTCGGGGAACTGGCCATGGTGCTGGACCAGATTGAGGCGGAGCTGGAGAAGAGGAAGCTGGAGAACG
  AGGGGCAGAAATGCGAGCTGTGGCTCTGTGGCTGTGCCTTCACCCTCGCTGATGTCCTCCTGGGAGCCAC
  CCTGCACCGCCTCAAGTTCCTGGGACTGTCCAAGAAATACTGGGAAGATGGCAGCCGGCCCAACCTGCAG
  TCCTTCTTTGAGAGGGTCCAGAGACGCTTTGCCTTCCGGAAAGTCCTGGGTGACATCCACACCACCCTGC
  TGTCGGCCGTCATCCCCAATGCTTTCCGGCTGGTCAAGAGGAAACCCCCATCCTTCTTCGGGGCGTCCTT
  CCTCATGGGCTCCCTGGGTGGGATGGGCTACTTTGCCTACTGGTACCTCAAGAAAAAATACATCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256738
• ORF Size: 837 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256738.1, NP_001243667.1
• RefSeq Size: 2645
• RefSeq ORF: 837
• Locus ID: 78997
• Protein Families: Transmembrane
• Gene Summary: The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012]
  Transcript Variant: This variant (3) contains a distinct first exon and uses an alternate in-frame splice junction at the 5' end of an exon, compared to variant 1. The resulting isoform (3) is shorter at the N-terminus and lacks an internal segment compared to isoform 1.