GDAP1L1 (NM_001256740) Human Untagged Clone

CAT#: SC330512

GDAP1L1 (untagged) - Homo sapiens ganglioside induced differentiation associated protein 1-like 1 (GDAP1L1), transcript variant 5


  "NM_001256740" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GDAP1L1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GDAP1L1
Synonyms dJ881L22.1; dJ995J12.1.1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256740, the custom clone sequence may differ by one or more nucleotides


ATGGCGACCCCCAACAATCTGACCCCCACCAACTGCAGCTGGTGGCCCATCTCCGCGCTGGAGAGCGATG
CGGCCAAGCCAGCGGAGGCCCCCGACGCTCCCGAGGCGGCCAGCCCCGCCCATTGGCCCAGGGAGAGCCT
GGTTCTGTACCACTGGACCCAGTCCTTCAGCTCGCAGAAGGTGCGGCTGGTGATCGCCGAGAAGGGCCTG
GTGTGCGAGGAGCGGGACGTGAGCCTGCCACAGAGCGAGCACAAGGAGCCCTGGTTCATGCGGCTCAACC
TGGGCGAGGAGGTGCCCGTCATCATCCACCGCGACAACATCATCAGTGACTATGACCAGATCATTGACTA
TGTGGAGCGCACCTTCACAGGAGAGCACGTGGTGGCCCTGATGCCCGAGGTGGGCAGCCTGCAGCACGCA
CGGGTGCTGCAGTACCGGGAGCTGCTGGACGCACTGCCCATGGATGCCTACACGCATGGCTGCATCCTGC
ATCCCGAGCTCACCACCGACTCCATGATCCCCAAGTACGCCACGGCCGAGATCCGCAGGCAGAAATGCGA
GCTGTGGCTCTGTGGCTGTGCCTTCACCCTCGCTGATGTCCTCCTGGGAGCCACCCTGCACCGCCTCAAG
TTCCTGGGACTGTCCAAGAAATACTGGGAAGATGGCAGCCGGCCCAACCTGCAGTCCTTCTTTGAGAGGG
TCCAGAGACGCTTTGCCTTCCGGAAAGTCCTGGGTGACATCCACACCACCCTGCTGTCGGCCGTCATCCC
CAATGCTTTCCGGCTGGTCAAGAGGAAACCCCCATCCTTCTTCGGGGCGTCCTTCCTCATGGGCTCCCTG
GGTGGGATGGGCTACTTTGCCTACTGGTACCTCAAGAAAAAATACATCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001256740
ORF Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256740.1, NP_001243669.1
RefSeq Size 2585
RefSeq ORF 891
Locus ID 78997
Protein Families Transmembrane
Gene Summary The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (5) uses an alternate in-frame splice junction at the 5' end of an exon and lacks an alternate in-frame segment compared to variant 1. The resulting isoform (5) has the same N- and C-termini but is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.