GLUR3 (GRIA3) (NM_001256743) Human Untagged Clone

CAT#: SC330513

GRIA3 (untagged) - Homo sapiens glutamate receptor, ionotropic, AMPA 3 (GRIA3), transcript variant 3


  "NM_001256743" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GRIA3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GRIA3
Synonyms GluA3; GLUR-C; GLUR-K3; GLUR3; GLURC; MRX94
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256743, the custom clone sequence may differ by one or more nucleotides


ATGGCCAGGCAGAAGAAAATGGGGCAAAGCGTGCTCCGGGCGGTCTTCTTTTTAGTCCTGGGGCTTTTGG
GTCATTCTCACGGAGGATTCCCCAACACCATCAGCATAGGTGGACTTTTCATGAGAAACACAGTGCAGGA
GCACAGCGCTTTCCGCTTTGCCGTGCAGTTATACAACACCAACCAGAACACCACCGAGAAGCCCTTCCAT
TTGAATTACCACGTAGATCACTTGGATTCCTCCAATAGTTTTTCCGTGACAAATGCTTGTCCTGCTGAAA
GGGACTACCTGCCTTGGCCAGGAAGCATCAGGGAAAACAATTGGACAGCTCTGCCGTGCTGCAAAGATCA
TGGGCTGCTGCACCTAAAATGTTCACCAGGTGGGGCCCGCCAAAACTGGGCCTATTGTATCTGGGGCGTT
ACAGGTGAACTGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001256743
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256743.1, NP_001243672.1
RefSeq Size 1067 bp
RefSeq ORF 435 bp
Locus ID 2892
Cytogenetics Xq25
Protein Families Druggable Genome, Ion Channels: Glutamate Receptors, Transmembrane
Protein Pathways Long-term depression, Neuroactive ligand-receptor interaction
Gene Summary 'Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing at this locus results in different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3) lacks several exons and includes alternate 3' exons compared to variant 1. It encodes isoform 3, which is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.