GLUR3 (GRIA3) (NM_001256743) Human Untagged Clone
CAT#: SC330513
GRIA3 (untagged) - Homo sapiens glutamate receptor, ionotropic, AMPA 3 (GRIA3), transcript variant 3
"NM_001256743" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "GRIA3"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GRIA3 |
Synonyms | GluA3; GLUR-C; GLUR-K3; GLUR3; GLURC; MRX94 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256743, the custom clone sequence may differ by one or more nucleotides
ATGGCCAGGCAGAAGAAAATGGGGCAAAGCGTGCTCCGGGCGGTCTTCTTTTTAGTCCTGGGGCTTTTGG GTCATTCTCACGGAGGATTCCCCAACACCATCAGCATAGGTGGACTTTTCATGAGAAACACAGTGCAGGA GCACAGCGCTTTCCGCTTTGCCGTGCAGTTATACAACACCAACCAGAACACCACCGAGAAGCCCTTCCAT TTGAATTACCACGTAGATCACTTGGATTCCTCCAATAGTTTTTCCGTGACAAATGCTTGTCCTGCTGAAA GGGACTACCTGCCTTGGCCAGGAAGCATCAGGGAAAACAATTGGACAGCTCTGCCGTGCTGCAAAGATCA TGGGCTGCTGCACCTAAAATGTTCACCAGGTGGGGCCCGCCAAAACTGGGCCTATTGTATCTGGGGCGTT ACAGGTGAACTGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256743 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001256743.1, NP_001243672.1 |
RefSeq Size | 1067 bp |
RefSeq ORF | 435 bp |
Locus ID | 2892 |
Cytogenetics | Xq25 |
Protein Families | Druggable Genome, Ion Channels: Glutamate Receptors, Transmembrane |
Protein Pathways | Long-term depression, Neuroactive ligand-receptor interaction |
Gene Summary | 'Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing at this locus results in different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (3) lacks several exons and includes alternate 3' exons compared to variant 1. It encodes isoform 3, which is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.