CD300 antigen (CD300A) (NM_001256841) Human Untagged Clone

CAT#: SC330532

CD300A (untagged) - Homo sapiens CD300a molecule (CD300A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD300A
• Synonyms: CLM-8; CMRF-35-H9; CMRF-35H; CMRF35-H; CMRF35-H9; CMRF35H; CMRF35H9; IGSF12; IRC1; IRC1/IRC2; IRC2; IRp60
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256841, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGGCTGCCTTGGGCTCTGTTGCTTCTCTGGGTCCCAGCATCAACGTCAATGACACCTGCAAGTATCA
  CTGCGGCCAAGACCTCAACAATCACAACTGCATTTCCACCTGTATCATCCACTACCCTGTTTGCAGTGGG
  TGCCACCCACAGTGCCAGCATCCAGGAGGAAACTGAGGAGGTGGTGAACTCACAGCTCCCGCTGCTCCTC
  TCCCTGCTGGCATTGTTGCTGCTTCTGTTGGTGGGGGCCTCCCTGCTAGCCTGGAGGATGTTTCAGAAAT
  GGATCAAAGCTGGTGACCATTCAGAGCTGTCCCAGAACCCCAAGCAGGCTGCCACGCAGAGTGAGCTGCA
  CTACGCAAATCTGGAGCTGCTGATGTGGCCTCTGCAGGAAAAGCCAGCACCACCAAGGGAGGTGGAGGTG
  GAATACAGCACTGTGGCCTCCCCCAGGGAAGAACTTCACTATGCCTCGGTGGTGTTTGATTCTAACACCA
  ACAGGATAGCTGCTCAGAGGCCTCGGGAGGAGGAACCAGATTCAGATTACAGTGTGATAAGGAAGACATA
  G
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256841
• ORF Size: 561 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256841.1, NP_001243770.1
• RefSeq Size: 1554
• RefSeq ORF: 561
• Locus ID: 11314
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a member of the CD300 glycoprotein family of cell surface proteins found on leukocytes involved in immune response signaling pathways. This gene is located on chromosome 17 in a cluster with all but one of the other family members. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
  Transcript Variant: This variant (2) lacks an exon in the 5' coding region compared to variant 1. The resulting protein (isoform 2), also referred to as IRC1c, is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.