IKZF3 (NM_001257413) Human Untagged Clone
CAT#: SC330622
IKZF3 (untagged) - Homo sapiens IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 12
"NM_001257413" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "IKZF3"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IKZF3 |
Synonyms | AIO; AIOLOS; ZNFN1A3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001257413, the custom clone sequence may differ by one or more nucleotides
ATGGAAGATATACAAACAAATGCGGAACTGAAAAGCACTCAGGAGCAGTCTGTGCCCGCAGAAAGTGCAG CGGTTTTGAATGACTACAGTTTAACCAAATCTCATGAAATGGAAAATGTGGACAGTGGAGAAGGCCCAGC CAATGAAGATGAAGACATAGGAGGTGAGAAGCGCCACTGCTTTGATGTCAACTATAATTCAAGTTACATG TATGAGAAAGAGAGTGAGCTCATACAGACCCGCATGATGGACCAAGCCATCAATAACGCCATCAGCTATC TTGGCGCCGAAGCCCTGCGCCCCTTGGTCCAGACACCGCCTGCTCCCACCTCGGAGATGGTTCCAGTTAT CAGCAGCATGTATCCCATAGCCCTCACCCGGGCTGAGATGTCAAACGGTGCCCCTCAAGAGCTGGAAAAG AAAAGCATCCACCTTCCAGAGAAGAGCGTGCCTTCTGAGAGAGGCCTCTCTCCCAACAATAGTGGCCACG ACTCCACGGACACTGACAGCAACCATGAAGAACGCCAGAATCACATCTATCAGCAAAATCACATGGTCCT GTCTCGGGCCCGCAATGGGATGCCACTTCTGAAGGAGGTTCCCCGCTCTTACGAACTCCTCAAGCCCCCG CCCATCTGCCCAAGAGACTCCGTCAAAGTGATCAACAAGGAAGGGGAGGTGATGGATGTGTATCGGTGTG ACCACTGCCGCGTCCTCTTCCTGGACTATGTGATGTTCACGATTCACATGGGCTGCCACGGCTTCCGTGA CCCTTTCGAGTGTAACATGTGTGGATATCGAAGCCATGATCGGTATGAGTTCTCGTCTCACATAGCCAGA GGAGAACACAGAGCCCTGCTGAAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001257413 |
ORF Size | 867 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001257413.1, NP_001244342.1 |
RefSeq Size | 9023 |
RefSeq ORF | 867 |
Locus ID | 22806 |
Gene Summary | This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (12) lacks four alternate in-frame exons compared to variant 1. The resulting isoform (12, also known as Aio-del3,4,5,6) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.