KCTD1 (NM_001258221) Human Untagged Clone

CAT#: SC330646

KCTD1 (untagged) - Homo sapiens potassium channel tetramerization domain containing 1 (KCTD1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCTD1
• Synonyms: C18orf5
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001258221, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCAAGACCTCTGATCACTAGATCCCCTGCATCTCCACTGAACAACCAAGGCATCCCTACTCCAGCAC
  AACTCACAAAATCCAATGCGCCTGTCCACATTGATGTGGGCGGCCACATGTACACCAGCAGCCTGGCCAC
  CCTCACCAAATACCCTGAATCCAGAATCGGAAGACTTTTTGATGGTACAGAGCCCATTGTTTTGGACAGT
  CTCAAACAGCACTATTTCATTGACAGAGATGGACAGATGTTCAGATATATCTTGAATTTTCTACGAACAT
  CCAAACTCCTCATTCCTGATGATTTCAAGGACTACACTTTGTTATATGAAGAGGCAAAATATTTTCAGCT
  TCAGCCCATGTTGTTGGAGATGGAAAGATGGAAGCAGGACAGAGAAACTGGTCGATTTTCAAGGCCCTGT
  GAGTGCCTCGTCGTGCGTGTGGCCCCAGACCTCGGAGAAAGGATCACGCTAAGCGGTGACAAATCCTTGA
  TAGAAGAAGTATTTCCAGAGATCGGCGACGTGATGTGTAACTCTGTCAATGCAGGCTGGAATCACGACTC
  GACGCACGTCATCAGGTTTCCACTAAATGGCTACTGTCACCTCAACTCAGTCCAGGTCCTCGAGAGGTTG
  CAGCAAAGAGGATTTGAAATCGTGGGCTCCTGTGGGGGAGGAGTAGACTCGTCCCAGTTCAGCGAATACG
  TCCTTCGGCGGGAACTGAGGCGGACGCCCCGTGTACCCTCCGTCATCCGGATAAAGCAAGAGCCTCTGGA
  CTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001258221
• ORF Size: 774 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001258221.1, NP_001245150.1
• RefSeq Size: 1715
• RefSeq ORF: 774
• Locus ID: 284252
• Protein Families: Ion Channels: Other
• Gene Summary: This gene encodes a protein containing a BTB (Broad-complex, tramtrack and bric a brac), also known as a POZ (POxvirus and zinc finger) protein-protein interaction domain. The encoded protein negatively regulates the AP-2 family of transcription factors and the Wnt signaling pathway. A mechanism for the modulation of Wnt signaling has been proposed in which the encoded protein enhances ubiquitination and degradation of the beta-catenin protein. Mutations in this gene have been identified in Scalp-ear-nipple (SEN) syndrome. [provided by RefSeq, May 2017]
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 3. Variants 1, 2, 4 and 6 all encode the same isoform (a), which has a shorter N-terminus compared to isoform b.