KCTD1 (NM_001258222) Human Untagged Clone

CAT#: SC330647

KCTD1 (untagged) - Homo sapiens potassium channel tetramerization domain containing 1 (KCTD1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCTD1
• Synonyms: C18orf5
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001258222, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTTCAGGACAGTCGGCCCAATATGTCAAGACCTCTGATCACTAGATCCCCTGCATCTCCACTGAACA
  ACCAAGGCATCCCTACTCCAGCACAACTCACAAAATCCAATGCGCCTGTCCACATTGATGTGGGCGGCCA
  CATGTACACCAGCAGCCTGGCCACCCTCACCAAATACCCTGAATCCAGAATCGGAAGACTTTTTGATGGT
  ACAGAGCCCATTGTTTTGGACAGTCTCAAACAGCACTATTTCATTGACAGAGATGGACAGATGTTCAGAT
  ATATCTTGAATTTTCTACGAACATCCAAACTCCTCATTCCTGATGATTTCAAGGACTACACTTTGTTATA
  TGAAGAGGCAAAATATTTTCAGCTTCAGCCCATGTTGTTGGAGATGGAAAGATGGAAGCAGGACAGAGAA
  ACTGGTCGATTTTCAAGGCCCTGTGAGTGCCTCGTCGTGCGTGTGGCCCCAGACCTCGGAGAAAGGATCA
  CGCTAAGCGGTGACAAATCCTTGATAGAAGAAGTATTTCCAGAGATCGGCGACGTGATGTGTAACTCTGT
  CAATGCAGGCTGGAATCACGACTCGACGCACGTCATCAGGTTTCCACTAAATGGCTACTGTCACCTCAAC
  TCAGTCCAGGTCCTCGAGAGGTTGCAGCAAAGAGGATTTGAAATCGTGGGCTCCTGTGGGGGAGGAGTAG
  ACTCGTCCCAGTTCAGCGAATACGTCCTTCGGCGGGAACTGAGGCGGACGCCCCGTGTACCCTCCGTCAT
  CCGGATAAAGCAAGAGCCTCTGGACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001258222
• ORF Size: 798 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001258222.1, NP_001245151.1
• RefSeq Size: 1671
• RefSeq ORF: 798
• Locus ID: 284252
• Protein Families: Ion Channels: Other
• Gene Summary: This gene encodes a protein containing a BTB (Broad-complex, tramtrack and bric a brac), also known as a POZ (POxvirus and zinc finger) protein-protein interaction domain. The encoded protein negatively regulates the AP-2 family of transcription factors and the Wnt signaling pathway. A mechanism for the modulation of Wnt signaling has been proposed in which the encoded protein enhances ubiquitination and degradation of the beta-catenin protein. Mutations in this gene have been identified in Scalp-ear-nipple (SEN) syndrome. [provided by RefSeq, May 2017]
  Transcript Variant: This variant (5) differs in the 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 3. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform b.