Histidase (HAL) (NM_001258333) Human Untagged Clone

CAT#: SC330664

HAL (untagged) - Homo sapiens histidine ammonia-lyase (HAL), transcript variant 2


  "NM_001258333" in other vectors (2)

Reconstitution Protocol

USD 460.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HAL
Synonyms HIS; HSTD
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001258333, the custom clone sequence may differ by one or more nucleotides


ATGCTCTTGGCTTTAAGGATCAATGTCTTAGCCAAAGGATACAGTGGCATTTCCCTGGAGACCCTCAAAC
AAGTCATAGAAATGTTTAATGCCTCCTGCCTGCCCTATGTCCCAGAGAAAGGAACCGTTGGTGCCAGTGG
AGACCTTGCCCCACTCTCTCATCTTGCTCTTGGGCTAGTTGGAGAAGGGAAGATGTGGTCTCCGAAGAGT
GGCTGGGCTGATGCTAAATACGTGCTAGAAGCCCATGGATTGAAACCAGTTATTTTAAAACCAAAAGAGG
GCCTGGCACTCATCAATGGGACGCAGATGATCACATCCCTGGGCTGTGAAGCTGTAGAGCGAGCCAGTGC
TATTGCACGGCAGGCTGACATTGTGGCAGCCCTGACCCTTGAGGTGCTGAAGGGCACCACCAAAGCCTTT
GACACTGACATTCATGCTCTTCGACCTCACCGTGGGCAAATTGAAGTTGCTTTTCGGTTTCGGTCACTCT
TGGACTCAGATCACCACCCATCAGAAATAGCAGAGAGTCACAGGTTCTGTGATCGCGTCCAGGATGCATA
CACCTTGCGCTGCTGTCCACAGGTCCATGGTGTGGTGAATGATACAATAGCATTTGTGAAGAACATCATT
ACCACAGAACTGAACAGCGCAACAGATAATCCTATGGTCTTTGCCAATAGGGGAGAGACAGTTTCTGGAG
GAAACTTCCATGGTGAATACCCAGCCAAAGCCCTAGACTACTTGGCCATTGGCATCCATGAACTTGCTGC
AATCAGTGAGAGAAGAATCGAGCGGCTCTGCAATCCCTCCCTCAGTGAGCTGCCTGCCTTCCTGGTGGCT
GAAGGTGGTCTGAACTCTGGGTTCATGATAGCTCACTGCACGGCAGCAGCCCTTGTTTCTGAGAACAAGG
CTCTGTGCCATCCCTCGTCTGTTGACTCCCTCTCCACCAGCGCAGCCACGGAGGACCACGTCTCCATGGG
AGGATGGGCAGCAAGGAAAGCCCTCAGGGTCATCGAGCATGTGGAGCAAGTGCTGGCCATCGAGCTCCTT
GCAGCCTGCCAGGGCATAGAGTTTCTACGTCCCCTGAAAACAACCACTCCGCTGGAGAAGGTCTATGACC
TGGTGCGCTCTGTTGTAAGGCCCTGGATAAAAGATCGCTTCATGGCCCCGGACATCGAGGCAGCCCACAG
GCTGCTCCTGGAGCAGAAGGTTTGGGAAGTAGCTGCTCCATACATTGAAAAATACAGAATGGAGCATATT
CCAGAATCAAGACCTCTTTCTCCAACAGCCTTTTCACTGCAATTTCTGCACAAGAAATCCACCAAAATCC
CGGAGTCTGAGGACCTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001258333
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001258333.1, NP_001245262.1
RefSeq Size 3860 bp
RefSeq ORF 1350 bp
Locus ID 3034
Cytogenetics 12q23.1
Protein Families Druggable Genome
Protein Pathways Histidine metabolism, Metabolic pathways, Nitrogen metabolism
Gene Summary 'Histidine ammonia-lyase is a cytosolic enzyme catalyzing the first reaction in histidine catabolism, the nonoxidative deamination of L-histidine to trans-urocanic acid. Histidine ammonia-lyase defects cause histidinemia which is characterized by increased histidine and histamine and decreased urocanic acid in body fluids. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]'
Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.