DAP13 (NDUFA12) (NM_001258338) Human Untagged Clone

CAT#: SC330665

NDUFA12 (untagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 (NDUFA12), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NDUFA12
• Synonyms: B17.2; DAP13; MC1DN23
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001258338, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGTTAGTGCAGGTCCTGAAACGCGGGCTGCAGCAGATCACCGGCCACGGCGGTCTCCGAGGCTATC
  TACGGGTTTTTTTCAGGACAAATGATGCGAAGGTTGGTACATTAGTGGGGGAAGACAAATATGGAAACAA
  ATACTATGAAGACAACAAGCAATTTTTTGGCATCGTTGGCTTCACAGTATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001258338
• ORF Size: 192 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001258338.1, NP_001245267.1
• RefSeq Size: 504
• RefSeq ORF: 192
• Locus ID: 55967
• Gene Summary: This gene encodes a protein which is part of mitochondrial complex 1, part of the oxidative phosphorylation system in mitochondria. Complex 1 transfers electrons to ubiquinone from NADH which establishes a proton gradient for the generation of ATP. Mutations in this gene are associated with Leigh syndrome due to mitochondrial complex 1 deficiency. Pseudogenes of this gene are located on chromosomes 5 and 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
  Transcript Variant: This variant (2) lacks an alternate exon which results in a frameshift and an early stop codon compared to variant 1. The resulting protein (isoform b) is shorter and has a distinct C-terminus compared to isoform a.