SPT3 (SUPT3H) (NM_001261823) Human Untagged Clone

CAT#: SC330724

SUPT3H (untagged) - Homo sapiens suppressor of Ty 3 homolog (S. cerevisiae) (SUPT3H), transcript variant 3


  "NM_001261823" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SUPT3H"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SUPT3H
Synonyms SPT3; SPT3L
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001261823, the custom clone sequence may differ by one or more nucleotides


ATGTTTGAAGATGACGAAATTGATGAAGTTAAACAAGAAAGAATGGAGAGAGCAGAAAGACAAACTCGAA
TTATGGATTCAGCTCAATATGCAGAATTCTGTGAAAGTCGACAATTAAGTTTCTCCAAAAAAGCTTCCAA
ATTTCGAGACTGGTTGGACTGCAGCAGTATGGAGATAAAACCCAATGTTGTCGCAATGGAAATCTTAGCA
TATTTAGCGTATGAAACTGTGGCACAGTTAGTGGATCTGGCTCTTCTTGTGAGGCAAGACATGGTAACCA
AGGCAGGGGACCCCTTCAGCCATGCCATTTCTGCAACCTTCATTCAGTATCACAACTCTGCTGAGAGCAC
TGCAGCCTGTGGTGTTGAGGCTCACAGCGATGCCATCCAGCCCTGCCACATCAGAGAGGCCATTCGACGC
TACAGCCACAGGATTGGCCCACTTTCCCCATTCACAAATGCCTACCGCAGGAATGGGATGGCTTTTCTAG
CCTGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001261823
ORF Size 498 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001261823.1, NP_001248752.1
RefSeq Size 4233
RefSeq ORF 498
Locus ID 8464
Protein Families Stem cell - Pluripotency, Transcription Factors
Gene Summary Probable transcriptional activator. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) encodes isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.