SPT3 (SUPT3H) (NM_001261823) Human Untagged Clone
CAT#: SC330724
SUPT3H (untagged) - Homo sapiens suppressor of Ty 3 homolog (S. cerevisiae) (SUPT3H), transcript variant 3
"NM_001261823" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "SUPT3H"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SUPT3H |
Synonyms | SPT3; SPT3L |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001261823, the custom clone sequence may differ by one or more nucleotides
ATGTTTGAAGATGACGAAATTGATGAAGTTAAACAAGAAAGAATGGAGAGAGCAGAAAGACAAACTCGAA TTATGGATTCAGCTCAATATGCAGAATTCTGTGAAAGTCGACAATTAAGTTTCTCCAAAAAAGCTTCCAA ATTTCGAGACTGGTTGGACTGCAGCAGTATGGAGATAAAACCCAATGTTGTCGCAATGGAAATCTTAGCA TATTTAGCGTATGAAACTGTGGCACAGTTAGTGGATCTGGCTCTTCTTGTGAGGCAAGACATGGTAACCA AGGCAGGGGACCCCTTCAGCCATGCCATTTCTGCAACCTTCATTCAGTATCACAACTCTGCTGAGAGCAC TGCAGCCTGTGGTGTTGAGGCTCACAGCGATGCCATCCAGCCCTGCCACATCAGAGAGGCCATTCGACGC TACAGCCACAGGATTGGCCCACTTTCCCCATTCACAAATGCCTACCGCAGGAATGGGATGGCTTTTCTAG CCTGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001261823 |
ORF Size | 498 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001261823.1, NP_001248752.1 |
RefSeq Size | 4233 |
RefSeq ORF | 498 |
Locus ID | 8464 |
Protein Families | Stem cell - Pluripotency, Transcription Factors |
Gene Summary | Probable transcriptional activator. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) encodes isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.