MRG15 (MORF4L1) (NM_001265604) Human Untagged Clone

CAT#: SC330740

MORF4L1 (untagged) - Homo sapiens mortality factor 4 like 1 (MORF4L1), transcript variant 4


  "NM_001265604" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MORF4L1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MORF4L1
Synonyms Eaf3; FWP006; HsT17725; MEAF3; MORFRG15; MRG15; S863-6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001265604, the custom clone sequence may differ by one or more nucleotides


ATGAGAGGGGCTGCCCCAGGAAAGAAGACATCTGGTCTGCAACAGAAAAATGTTGAAGTGAAAACGAAAA
AGAACAAACAGAAAACACCTGGAAATGGAGATGGTGGCAGTACCAGTGAGACCCCTCAGCCTCCTCGGAA
GAAAAGGGCCCGGGTAGATCCTACTGTTGAAAATGAGGAAACATTCATGAACAGAGTTGAAGTTAAAGTA
AAGATTCCTGAAGAGCTAAAACCGTGGCTTGTTGATGACTGGGACTTAATTACCAGGCAAAAACAGCTCT
TTTATCTTCCTGCCAAGAAGAATGTGGATTCCATTCTTGAGGATTATGCAAATTACAAGAAATCTCGTGG
AAACACAGATAATAAGGAGTATGCGGTTAATGAAGTTGTGGCAGGGATAAAAGAATACTTCAACGTAATG
TTGGGTACCCAGCTACTCTATAAATTTGAGAGACCACAGTATGCTGAAATTCTTGCAGATCATCCCGATG
CACCCATGTCCCAGGTGTATGGAGCGCCACATCTCCTGAGATTATTTGTACGAATTGGAGCAATGTTGGC
TTATACACCTCTGGATGAGAAGAGCCTTGCTTTATTACTCAATTATCTTCACGATTTCCTAAAGTACCTG
GCAAAGAATTCTGCAACTTTGTTCAGTGCCAGCGATTATGAAGTGGCTCCTCCTGAGTACCATCGGAAAG
CTGTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001265604
ORF Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001265604.1, NP_001252533.1
RefSeq Size 1847
RefSeq ORF 708
Locus ID 10933
Protein Families Transcription Factors
Gene Summary Component of the NuA4 histone acetyltransferase (HAT) complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. The NuA4 complex ATPase and helicase activities seem to be, at least in part, contributed by the association of RUVBL1 and RUVBL2 with EP400. NuA4 may also play a direct role in DNA repair when directly recruited to sites of DNA damage. Also component of the mSin3A complex which acts to repress transcription by deacetylation of nucleosomal histones. Required for homologous recombination repair (HRR) and resistance to mitomycin C (MMC). Involved in the localization of PALB2, BRCA2 and RAD51, but not BRCA1, to DNA-damage foci. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants 3, 4 and 5 encode the same isoform (3), which has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.