Integrin beta 4 binding protein (EIF6) (NM_001267810) Human Untagged Clone
CAT#: SC330793
EIF6 (untagged) - Homo sapiens eukaryotic translation initiation factor 6 (EIF6), transcript variant 6
"NM_001267810" in other vectors (2)
Product Images
![](https://origeneresource2.s3.us-east-2.amazonaws.com/cmsstatics/img/defaults-img-expression-plasmids.jpg)
Other products for "EIF6"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EIF6 |
Synonyms | b(2)gcn; CAB; eIF-6; EIF3A; ITGB4BP; p27(BBP); p27BBP |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001267810, the custom clone sequence may differ by one or more nucleotides
ATGGCGGTCCGAGCTTCGTTCGAGAACAACTGTGAGATCGGCTGCTTTGCCAAGCTCACCAACACCTACT GTCTGGTAGCGATCGGAGGCTCAGAGAACTTCTACAGTGTGTTCGAGGGCGAGCTCTCCGATACCATCCC CGTGGTGCACGCGTCTATCGCCGGCTGCCGCATCATCGGGCGCATGTGTGTGGGGAACAGGCACGGTCTC CTGGTACCCAACAATACCACCGACCAGGAGCTGCAACACATTCGCAACAGCCTCCCAGACACAGTGCAGA TTAGGCGGGTGGAGGAGCGGCTCTCAGCCTTGGGCAATGTCACCACCTGCAATGACTACGTGGCCTTGGT CCACCCAGACTTGGACAGGGAGACAGAAGAAATTCTGGCAGATGTGCTCAAGGTGGAAGTCTTCAGACAG ACAGTGGCCGACCAGGTGCTAGTAGGAAGCTACTGTGTCTTCAGCAATCAGGGAGGGCTGGTGCATCCCA AGACTTCAATTGAAGACCAGGATGAGCTGTCCTCTCTTCTTCAAGTCCCCCTTGTGGCGGGGACTGTGAA CCGAGGCAGTGAGGTGATTGCTGCTGGGATGGTGGTGAATGACTGGTGTGCCTTCTGTGGCCTGGACACA ACCAGCACAGAGCTGTCAGTGGTGGAGAGTGTCTTCAAGCTGAATGAAGCCCAGCCTAGCACCATTGCCA CCAGCATGCGGGATTCCCTCATTGACAGCCTCACCTGA |
Restriction Sites | SgfI-NotI |
ACCN | NM_001267810 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001267810.1, NP_001254739.1 |
RefSeq Size | 1065 bp |
RefSeq ORF | 738 bp |
Locus ID | 3692 |
Cytogenetics | 20q11.22 |
Protein Families | Druggable Genome |
Gene Summary | 'Hemidesmosomes are structures which link the basal lamina to the intermediate filament cytoskeleton. An important functional component of hemidesmosomes is the integrin beta-4 subunit (ITGB4), a protein containing two fibronectin type III domains. The protein encoded by this gene binds to the fibronectin type III domains of ITGB4 and may help link ITGB4 to the intermediate filament cytoskeleton. The encoded protein, which is insoluble and found both in the nucleus and in the cytoplasm, can function as a translation initiation factor and prevent the association of the 40S and 60S ribosomal subunits. Multiple non-protein coding transcript variants and variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]' Transcript Variant: This variant (6) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 6 all encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.