TP53TG3 (NM_001267813) Human Untagged Clone

CAT#: SC330794

TP53TG3 (untagged) - Homo sapiens TP53 target 3 (TP53TG3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TP53TG3
• Synonyms: P53TG3; TP53TG3A
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001267813, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGCGCCTCACCCTGCATCTCCCAGCCCGCAGCCAGCTGGCATCCTAGACCCTCTGCCCTGCGACCAA
  CAGCCGGGAGCGGACCAGACACCAGAACTCCCGGAACGGTTGAAGACGGTTCCGCTCCCTGTCCCGCCTT
  TCGCAGCCCAGCAGTTTCGCCCTGCGGAGAGGAGCCTTGCTGTTTCCAAATCTCTCCTGCTGAAGAGACA
  TTGGAGCTAGGGCGGCTAGTTTCACCTGGCTGTCACAAATCCTCTGCACCCCAGGAGCGCCGCTTGGACC
  CCCGGGCTCGCTGCGTGGTCCATATCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001267813
• ORF Size: 309 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001267813.1, NP_001254742.1
• RefSeq Size: 1806
• RefSeq ORF: 309
• Locus ID: 24150