ST3GAL3 (NM_001270465) Human Untagged Clone
CAT#: SC330845
ST3GAL3 (untagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (ST3GAL3), transcript variant 17
"NM_001270465" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ST3GAL3 |
Synonyms | EIEE15; MRT12; SIAT6; ST3GALII; ST3Gal III; ST3GalIII; ST3N |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001270465, the custom clone sequence may differ by one or more nucleotides
ATGGGACTCTTGGTATTTGTGCGCAATCTGCTGCTAGCCCTCTGCCTCTTTCTGGTACTGGGATTTTTGT ATTATTCTGCGTGGAAGCTACACTTACTCCAGTGGGAGGAGGACTCCAGTAAGTATAGTCACTCTAGCTC ACCCCAGGAGAAGCCTGTTGCAGAGTATGATCGGTTGGGCTTCCTCCTGAATCTGGACTCTAAACTGCCT GCTGAATTAGCCACCAAGTACGCAAACTTTTCAGAGGGAGCTTGCAAGCCTGGCTATGCTTCAGCCTTGA TGACGGCCATCTTCCCCCGGTTCTCCAAGCCAGCACCCATGTTCCTGGATGACTCCTTTCGCAAGTGGGC TAGAATCCGGGAGTTCGTGCCGCCTTTTGGGATCAAAGGTCAAGACAATCTGATCAAAGCCATCTTGTCA GTCACCAAAGAGTACCGCCTGACCCCTGCCTTGGACAGCCTCCGCTGCCGCCGCTGCATCATCGTGGGCA ATGGAGGCGTTCTTGCCAACAAGTCTCTGGGGTCACGAATTGACGACTATGACATTGTGGTGAGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270465 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270465.1, NP_001257394.1 |
RefSeq Size | 1836 bp |
RefSeq ORF | 558 bp |
Locus ID | 6487 |
Cytogenetics | 1p34.1 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | Glycosphingolipid biosynthesis - lacto and neolacto series, Keratan sulfate biosynthesis, Metabolic pathways |
Gene Summary | 'The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Mutations in this gene have been associated with a form of autosomal recessive nonsymdromic cognitive disability as well as infantile epileptic encephalopathy. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2017]' Transcript Variant: This variant (17) lacks two alternate in-frame exons, uses an alternate splice site which results in a frameshift and lacks an exon in the 3' coding region compared to variant 1. The resulting isoform (q, also called D2+26) has a shorter and distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232015 | ST3GAL3 (Myc-DDK tagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (ST3GAL3), transcript variant 17 |
USD 420.00 |
|
RG232015 | ST3GAL3 (GFP-tagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (ST3GAL3), transcript variant 17 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review