CA6 (NM_001270500) Human Untagged Clone

CAT#: SC330853

CA6 (untagged) - Homo sapiens carbonic anhydrase VI (CA6), transcript variant 2


  "NM_001270500" in other vectors (2)

Reconstitution Protocol

USD 320.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CA6
Synonyms CA-VI; GUSTIN
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270500, the custom clone sequence may differ by one or more nucleotides


ATGAGGGCCCTGGTGCTTCTGCTGTCCCTGTTCCTGCTGGGTGGCCAGGCCCAGCATGTGTCTGACTGGA
CCTACTCAGAAGGGGCACTGGACGAAGCGCACTGGCCACAGCACTACCCCGCCTGTGGGGGCCAGAGACA
GTCGCCTATCAACCTACAGAGGACGAAGGTGCGGTACAACCCCTCCTTGAAGGGGCTCAATATGACAGGC
TATGAGACCCAGGCAGGGGAGTTCCCCATGGTCAACAATGGCCACACAGTGCAGATCAGCCTGCCCTCCA
CCATGCGCATGACAGTGGCTGACGGCACTGTATACATAGCCCAGCAGATGCACTTTCACTGGGGAGGTGC
GTCCTCGGAGATCAGCGGCTCTGAGCACACCGTGGACGGGATCAGACATGTGATCGAGATTCACATTGTT
CACTACAATTCTAAATACAAGAGCTATGATATAGCCCAAGATGCGCCGGATGGTTTGGCTGTACTGGCAG
CCTTCGTTGAGGTGAAGAATTACCCTGAAAACACTTATTACAGCAACTTCATTTCTCATCTGGCCAACAT
CAAGTACCCAGGACAAAGAACAACCCTGACTGGCCTTGACGTTCAGGACATGCTGCCCAGGAACCTCCAG
CACTACTACACCTACCATGGCTCACTCACCACGCCTCCCTGCACTGAGAACGTCCACTGGTTTGTGCTGG
CAGATTTTGTCAAGCTCTCCAGGACACAGGTTTGGAAGCTGGAGAATTCCTTACTGGATCACCGCAACAA
GACCATCCACAACGATTACCGCAGGACCCAGCCCCTGAACCACAGAGTGGTGGAATCCAACTTCCCGAAT
CAGGGCAAGGGCCACGGGGGGCATCGTGGGAGAAGCCAAAATCCAAGAGTACAGCCCACCTCAACACGCC
ACCCCTTGGCTCTGGGCAGCTTAGAAGCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001270500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270500.1, NP_001257429.1
RefSeq Size 995 bp
RefSeq ORF 942 bp
Locus ID 765
Cytogenetics 1p36.23
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Nitrogen metabolism
Gene Summary 'The protein encoded by this gene is one of several isozymes of carbonic anhydrase. This protein is found only in salivary glands and saliva and protein may play a role in the reversible hydratation of carbon dioxide though its function in saliva is unknown. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. The resulting isoform (2) has a longer and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.