MCU (NM_001270680) Human Untagged Clone

CAT#: SC330865

MCU (untagged) - Homo sapiens mitochondrial calcium uniporter (MCU), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MCU
• Synonyms: C10orf42; CCDC109A; HsMCU
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270680, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTACACCAGAGGATCGCTTCCTGGCAGAATTTGGGAGCTGTTTATTGCAGCACTGTTGTGCCCTCTG
  ATGATGTTACAGTGGTTTATCAAAATGGGTTACCTGTGATATCTGTGAGGCTACCATCCCGGCGTGAACG
  CTGTCAGTTCACACTCAAGCCTATCTCTGACTCTGTTGGTGTATTTTTACGACAACTGCAAGAAGAGGAT
  CGGGGAATTGACAGAGTTGCTATCTATTCACCAGATGGTGTTCGCGTTGCTGCTTCAACAGGAATAGACC
  TCCTCCTCCTTGATGACTTTAAGCTGGTCATTAATGACTTAACATACCACGTACGACCACCAAAAAGAGA
  CCTCTTAAGTCATGAAAATGCAGCAACGCTGAATGATGTAAAGACATTGGTCCAGCAACTATACACCACA
  CTGTGCATTGAGCAGCACCAGTTAAACAAGGAAAGGGAGCTTATTGAAAGACTAGAGGATCTCAAAGAGC
  AGCTGGCTCCCCTGGAAAAGGTACGAATTGAGATTAGCAGAAAAGCTGAGAAGAGGACCACTTTGGTGCT
  ATGGGGTGGCCTTGCCTACATGGCCACACAGTTTGGCATTTTGGCCCGGCTTACCTGGTGGGAATATTCC
  TGGGACATCATGGAGCCAGTAACATACTTCATCACTTATGGAAGTGCCATGGCAATGTATGCATATTTTG
  TAATGACACGCCAGGAATATGTTTATCCAGAAGCCAGAGACAGACAATACTTACTATTTTTCCATAAAGG
  AGCCAAAAAGTCACGTTTTGACCTAGAGAAATACAATCAACTCAAGGATGCAATTGCTCAGGCAGAAATG
  GACCTTAAGAGACTGAGAGACCCATTACAAGTACATCTGCCTCTCCGACAAATTGGTGAAAAAGATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270680
• ORF Size: 909 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_001270680.1, NP_001257609.1
• RefSeq Size: 3239
• RefSeq ORF: 909
• Locus ID: 90550
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a calcium transporter that localizes to the mitochondrial inner membrane. The encoded protein interacts with mitochondrial calcium uptake 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.