GNPDA2 (NM_001270880) Human Untagged Clone

CAT#: SC330881

GNPDA2 (untagged) - Homo sapiens glucosamine-6-phosphate deaminase 2 (GNPDA2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNPDA2
• Synonyms: GNP2; SB52
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270880, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGGCTTGTAATTCTTGATAACTATGACTTGGCTAGTGAATGGGCAGCCAAATACATCTGTAATCGCA
  TCATTCAGTTCAAACCTGGACAGGACAGATATTTTACACTGGGTTTACCAACAGGACTTCCAAGAAATCA
  TCCTGAAAGCTACCATTCTTATATGTGGAATAATTTTTTTAAGCATATCGATATAGATCCTAATAATGCA
  CATATCCTTGACGGGAATGCTGCAGATTTACAAGCAGAATGTGATGCTTTTGAAAACAAAATAAAAGAAG
  CTGGAGGAATAGATCTTTTTGTTGGAGGAATTGGTCCAGATGGTCATATCGCTTTCAATGAGCCTGGATC
  CAGTTTAGTGTCAAGGACAAGATTAAAGACTCTAGCAATGGATACCATCTTGGCAAATGCCAAATATTTT
  GATGGAGATTTATCAAAAGTGCCAACTATGGCTCTAACTGTTGGTGTGGGGACAGTGATGGATGCTAGAG
  AAGTAATGATCCTTATAACAGGGGCACACAAGGCATTTGCCCTGTACAAAGCAATAGAAGAAGGAGTCAA
  TCACATGTGGACTGTTTCCGCTTTCCAGCAGCATCCCCGGACTATTTTTGTATGCGATGAAGATGCTACT
  TTAGAATTAAGAGTTAAAACTGTGAAATACTTTAAAGGTCTAATGCATGTGCACAATAAACTTGTGGATC
  CACTATTCAGTATGAAAGATGGAAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270880
• ORF Size: 729 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270880.1, NP_001257809.1
• RefSeq Size: 2211
• RefSeq ORF: 729
• Locus ID: 132789
• Protein Pathways: Amino sugar and nucleotide sugar metabolism, Metabolic pathways
• Gene Summary: The protein encoded by this gene is an allosteric enzyme that catalyzes the reversible reaction converting D-glucosamine-6-phosphate into D-fructose-6-phosphate and ammonium. Variations of this gene have been reported to be associated with influencing body mass index and susceptibility to obesity. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 2 which is shorter than isoform 1.