GNPDA2 (NM_001270880) Human Untagged Clone
CAT#: SC330881
GNPDA2 (untagged) - Homo sapiens glucosamine-6-phosphate deaminase 2 (GNPDA2), transcript variant 2
"NM_001270880" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "GNPDA2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GNPDA2 |
Synonyms | GNP2; SB52 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001270880, the custom clone sequence may differ by one or more nucleotides
ATGAGGCTTGTAATTCTTGATAACTATGACTTGGCTAGTGAATGGGCAGCCAAATACATCTGTAATCGCA TCATTCAGTTCAAACCTGGACAGGACAGATATTTTACACTGGGTTTACCAACAGGACTTCCAAGAAATCA TCCTGAAAGCTACCATTCTTATATGTGGAATAATTTTTTTAAGCATATCGATATAGATCCTAATAATGCA CATATCCTTGACGGGAATGCTGCAGATTTACAAGCAGAATGTGATGCTTTTGAAAACAAAATAAAAGAAG CTGGAGGAATAGATCTTTTTGTTGGAGGAATTGGTCCAGATGGTCATATCGCTTTCAATGAGCCTGGATC CAGTTTAGTGTCAAGGACAAGATTAAAGACTCTAGCAATGGATACCATCTTGGCAAATGCCAAATATTTT GATGGAGATTTATCAAAAGTGCCAACTATGGCTCTAACTGTTGGTGTGGGGACAGTGATGGATGCTAGAG AAGTAATGATCCTTATAACAGGGGCACACAAGGCATTTGCCCTGTACAAAGCAATAGAAGAAGGAGTCAA TCACATGTGGACTGTTTCCGCTTTCCAGCAGCATCCCCGGACTATTTTTGTATGCGATGAAGATGCTACT TTAGAATTAAGAGTTAAAACTGTGAAATACTTTAAAGGTCTAATGCATGTGCACAATAAACTTGTGGATC CACTATTCAGTATGAAAGATGGAAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270880 |
ORF Size | 729 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001270880.1, NP_001257809.1 |
RefSeq Size | 2211 |
RefSeq ORF | 729 |
Locus ID | 132789 |
Protein Pathways | Amino sugar and nucleotide sugar metabolism, Metabolic pathways |
Gene Summary | The protein encoded by this gene is an allosteric enzyme that catalyzes the reversible reaction converting D-glucosamine-6-phosphate into D-fructose-6-phosphate and ammonium. Variations of this gene have been reported to be associated with influencing body mass index and susceptibility to obesity. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 2 which is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.