Epigen (EPGN) (NM_001270990) Human Untagged Clone
CAT#: SC330902
EPGN (untagged) - Homo sapiens epithelial mitogen (EPGN), transcript variant 2
"NM_001270990" in other vectors (2)
Product Images
Other products for "EPGN"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EPGN |
Synonyms | ALGV3072; EPG; PRO9904 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001270990, the custom clone sequence may differ by one or more nucleotides
ATGGCTTTGGGAGTTCCAATATCAGTCTATCTTTTATTCAACGCAATGACAGCACTGACCGAAGAGGCAG CCGTGACTGTAACACCTCCAATCACAGCCCAGCAAGGTAACTGGACAGTTAACAAAACAGAAGCTGACAA CATAGAAGGACCCATAGCCTTGAAGTTCTCACACCTTTGCCTGGAAGATCATAACAGTTACTGCATCAAC GGTGCTTGTGCATTCCACCATGAGCTAGAGAAAGCCATCTGCAGGTGTTTTACTGGTTATACTGGAGAAA GGTGTCTAAAATTGAAATCGCCTTACAATGTCTGTTCTGGAGAAAGACGACCACTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270990 |
ORF Size | 339 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001270990.1, NP_001257919.1 |
RefSeq Size | 2569 |
RefSeq ORF | 339 |
Locus ID | 255324 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the epidermal growth factor family. Members of this family are ligands for the epidermal growth factor receptor and play a role in cell survival, proliferation and migration. This protein has been reported to have high mitogenic activity but low affinity for its receptor. Expression of this transcript and protein have been reported in cancer specimens of the breast, bladder, and prostate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region compared to variant 1. It encodes isoform 2 (also known as isoform B) which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.