Epigen (EPGN) (NM_001270990) Human Untagged Clone

CAT#: SC330902

EPGN (untagged) - Homo sapiens epithelial mitogen (EPGN), transcript variant 2


  "NM_001270990" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "EPGN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EPGN
Synonyms ALGV3072; EPG; PRO9904
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270990, the custom clone sequence may differ by one or more nucleotides


ATGGCTTTGGGAGTTCCAATATCAGTCTATCTTTTATTCAACGCAATGACAGCACTGACCGAAGAGGCAG
CCGTGACTGTAACACCTCCAATCACAGCCCAGCAAGGTAACTGGACAGTTAACAAAACAGAAGCTGACAA
CATAGAAGGACCCATAGCCTTGAAGTTCTCACACCTTTGCCTGGAAGATCATAACAGTTACTGCATCAAC
GGTGCTTGTGCATTCCACCATGAGCTAGAGAAAGCCATCTGCAGGTGTTTTACTGGTTATACTGGAGAAA
GGTGTCTAAAATTGAAATCGCCTTACAATGTCTGTTCTGGAGAAAGACGACCACTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001270990
ORF Size 339 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270990.1, NP_001257919.1
RefSeq Size 2569
RefSeq ORF 339
Locus ID 255324
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is a member of the epidermal growth factor family. Members of this family are ligands for the epidermal growth factor receptor and play a role in cell survival, proliferation and migration. This protein has been reported to have high mitogenic activity but low affinity for its receptor. Expression of this transcript and protein have been reported in cancer specimens of the breast, bladder, and prostate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region compared to variant 1. It encodes isoform 2 (also known as isoform B) which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.