Epigen (EPGN) (NM_001270991) Human Untagged Clone

CAT#: SC330903

EPGN (untagged) - Homo sapiens epithelial mitogen (EPGN), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EPGN
• Synonyms: ALGV3072; EPG; PRO9904
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270991, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTTTGGGAGTTCCAATATCAGTCTATCTTTTATTCAACGCAATGACAGCACTGACCGAAGAGGCAG
  CCGTGACTGTAACACCTCCAATCACAGCCCAGCAAGCTGACAACATAGAAGGACCCATAGCCTTGAAGTT
  CTCACACCTTTGCCTGGAAGATCATAACAGTTACTGCATCAACGGTGCTTGTGCATTCCACCATGAGCTA
  GAGAAAGCCATCTGCAGGTGTTTTACTGGTTATACTGGAGAAAGGTGTCTAAAATTGAAATCGCCTTACA
  ATGTCTGTTCTGGAGAAAGACGACCACTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270991
• ORF Size: 312 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270991.1, NP_001257920.1
• RefSeq Size: 2542
• RefSeq ORF: 312
• Locus ID: 255324
• Protein Families: Transmembrane
• Gene Summary: The protein encoded by this gene is a member of the epidermal growth factor family. Members of this family are ligands for the epidermal growth factor receptor and play a role in cell survival, proliferation and migration. This protein has been reported to have high mitogenic activity but low affinity for its receptor. Expression of this transcript and protein have been reported in cancer specimens of the breast, bladder, and prostate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (3) uses alternate in-frame splice sites in two exons in the coding region compared to variant 1. It encodes isoform 3 (also known as isoform F) which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.