ST3GAL6 (NM_001271146) Human Untagged Clone

CAT#: SC330925

ST3GAL6 (untagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 6 (ST3GAL6), transcript variant 4


  "NM_001271146" in other vectors (2)

Reconstitution Protocol

USD 340.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ST3GAL6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ST3GAL6
Synonyms SIAT10; ST3GALVI
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271146, the custom clone sequence may differ by one or more nucleotides


ATGAGAGGGTATCTTGTGGCCATATTCCTGAGTGCTGTCTTCCTCTATTATGTACTGCATTGCATATTAT
GGGGAACGAATGTCTATTGGGTGGCACCTGTGGAAATGAAACGGAGAAATAAGATCCAGCCTTGTTTATC
AAAGCCAGCTTTTGCCTCTCTGCTGAGGTTTCATCAGTTTCACCCTTTTCTGTGTGCGGCTGATTTTAGA
AAGATTGCTTCCTTGTATGGTAGCGATAAGTTTGATTTGCCCTATGGGATGAGAACATCAGCGGAATATT
TTCGACTTGCTCTTTCAAAACTGCAGAGTTGTGATCTCTTTGATGAGTTTGACAACATACCCTGTAAAAA
GTGTGTGGTGGTTGGTAATGGAGGAGTTTTGAAGAATAAGACATTAGGAGAAAAAATCGACTCCTATGAT
GTAATAATAAGAATGAATAATGGTCCTGTTTTAGGACATGAAGAAGAAGTTGGGAGAAGGACAACCTTCC
GACTTTTTTATCCAGAATCTGTTTTTTCAGATCCTATTCACAATGACCCTAATACGACAGTGATTCTCAC
TGCTTTTAAGCCACATGATTTAAGGTGGCTGTTGGAATTGTTGATGGGTGACAAAATAAACACTAATGGT
TTTTGGAAGAAACCAGCCTTAAACCTGATTTATAAACCTTATCAAATCCGAATATTAGATCCTTTCATTA
TCAGAACAGCAGCTTATGAACTGCTTCATTTTCCAAAAGTGTTTCCCAAAAATCAGAAACCTAAACACCC
AACAACAGGAATTATTGCCATCACATTGGCGTTTTACATATGTCACGAAGTTCACCTAGCTGGTTTTAAA
TACAACTTTTCTGACCTCAAGAGTCCTTTGCACTACTATGGGAATGCCACCATGTCTTTGATGAATAAGA
ACGCGTATCACAATGTGACTGCAGAGCAGCTCTTTTTGAAGGACATTATAGAAAAAAACCTCGTAATCAA
CTTGACTCAAGATTGA


Restriction Sites SgfI-RsrII     
ACCN NM_001271146
ORF Size 996 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001271146.1, NP_001258075.1
RefSeq Size 3388
RefSeq ORF 996
Locus ID 10402
Protein Families Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
Gene Summary The protein encoded by this gene is a member of the sialyltransferase family. Members of this family are enzymes that transfer sialic acid from the activated cytidine 5'-monophospho-N-acetylneuraminic acid to terminal positions on sialylated glycolipids (gangliosides) or to the N- or O-linked sugar chains of glycoproteins. This protein has high specificity for neolactotetraosylceramide and neolactohexaosylceramide as glycolipid substrates and may contribute to the formation of selectin ligands and sialyl Lewis X, a carbohydrate important for cell-to-cell recognition and a blood group antigen. [provided by RefSeq, Apr 2016]
Transcript Variant: Variants 1, 4, 7, 8 and 9 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.