ST3GAL6 (NM_001271147) Human Untagged Clone

CAT#: SC330926

ST3GAL6 (untagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 6 (ST3GAL6), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ST3GAL6
• Synonyms: SIAT10; ST3GALVI
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271147, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGAACATCAGCGGAATATTTTCGACTTGCTCTTTCAAAACTGCAGAGTTGTGATCTCTTTGATGAGT
  TTGACAAAATGAATAATGGTCCTGTTTTAGGACATGAAGAAGAAGTTGGGAGAAGGACAACCTTCCGACT
  TTTTTATCCAGAATCTGTTTTTTCAGATCCTATTCACAATGACCCTAATACGACAGTGATTCTCACTGCT
  TTTAAGCCACATGATTTAAGGTGGCTGTTGGAATTGTTGATGGGTGACAAAATAAACACTAATGGTTTTT
  GGAAGAAACCAGCCTTAAACCTGATTTATAAACCTTATCAAATCCGAATATTAGATCCTTTCATTATCAG
  AACAGCAGCTTATGAACTGCTTCATTTTCCAAAAGTGTTTCCCAAAAATCAGAAACCTAAACACCCAACA
  ACAGGAATTATTGCCATCACATTGGCGTTTTACATATGTCACGAAGTTCACCTAGCTGGTTTTAAATACA
  ACTTTTCTGACCTCAAGAGTCCTTTGCACTACTATGGGAATGCCACCATGTCTTTGATGAATAAGAACGC
  GTATCACAATGTGACTGCAGAGCAGCTCTTTTTGAAGGACATTATAGAAAAAAACCTCGTAATCAACTTG
  ACTCAAGATTGA
  
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001271147
• ORF Size: 642 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271147.1, NP_001258076.1
• RefSeq Size: 3362
• RefSeq ORF: 642
• Locus ID: 10402
• Protein Families: Transmembrane
• Protein Pathways: Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
• Gene Summary: The protein encoded by this gene is a member of the sialyltransferase family. Members of this family are enzymes that transfer sialic acid from the activated cytidine 5'-monophospho-N-acetylneuraminic acid to terminal positions on sialylated glycolipids (gangliosides) or to the N- or O-linked sugar chains of glycoproteins. This protein has high specificity for neolactotetraosylceramide and neolactohexaosylceramide as glycolipid substrates and may contribute to the formation of selectin ligands and sialyl Lewis X, a carbohydrate important for cell-to-cell recognition and a blood group antigen. [provided by RefSeq, Apr 2016]