Progesterone Receptor (PGR) (NM_001271162) Human Untagged Clone

CAT#: SC330927

PGR (untagged) - Homo sapiens progesterone receptor (PGR), transcript variant 7


  "NM_001271162" in other vectors (2)

Reconstitution Protocol

USD 350.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PGR
Synonyms NR3C3; PR
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271162, the custom clone sequence may differ by one or more nucleotides


ATGGAAGGGCAGCACAACTACTTATGTGCTGGAAGAAATGACTGCATCGTTGATAAAATCCGCAGAAAAA
ACTGCCCAGCATGTCGCCTTAGAAAGTGCTGTCAGGCTGGCATGGTCCTTGGAGGTCGAAAATTTAAAAA
GTTCAATAAAGTCAGAGTTGTGAGAGCACTGGATGCTGTTGCTCTCCCACAGCCAGTGGGCGTTCCAAAT
GAAAGCCAAGCCCTAAGCCAGAGATTCACTTTTTCACCAGGTCAAGACATACAGTTGATTCCACCACTGA
TCAACCTGTTAATGAGCATTGAACCAGATGTGATCTATGCAGGACATGACAACACAAAACCTGACACCTC
CAGTTCTTTGCTGACAAGTCTTAATCAACTAGGCGAGAGGCAACTTCTTTCAGTAGTCAAGTGGTCTAAA
TCATTGCCAGGTTTTCGAAACTTACATATTGATGACCAGATAACTCTCATTCAGTATTCTTGGATGAGCT
TAATGGTGTTTGGTCTAGGATGGAGATCCTACAAACACGTCAGTGGGCAGATGCTGTATTTTGCACCTGA
TCTAATACTAAATGAACAGCGGATGAAAGAATCATCATTCTATTCATTATGCCTTACCATGTGGCAGATC
CCACAGGAGTTTGTCAAGCTTCAAGTTAGCCAAGAAGAGTTCCTCTGTATGAAAGTATTGTTACTTCTTA
ATACAATTCCTTTGGAAGGGCTACGAAGTCAAACCCAGTTTGAGGAGATGAGGTCAAGCTACATTAGAGA
GCTCATCAAGGCAATTGGTTTGAGGCAAAAAGGAGTTGTGTCGAGCTCACAGCGTTTCTATCAACTTACA
AAACTTCTTGATAACTTGCATGATCTTGTCAAACAACTTCATCTGTACTGCTTGAATACATTTATCCAGT
CCCGGGCACTGAGTGTTGAATTTCCAGAAATGATGTCTGAAGTTATTGCTGCACAATTACCCAAGATATT
GGCAGGGATGGTGAAACCCCTTCTCTTTCATAAAAAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001271162
ORF Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001271162.1, NP_001258091.1
RefSeq Size 10957
RefSeq ORF 1020
Locus ID 5241
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Oocyte meiosis, Progesterone-mediated oocyte maturation
Gene Summary This gene encodes a member of the steroid receptor superfamily. The encoded protein mediates the physiological effects of progesterone, which plays a central role in reproductive events associated with the establishment and maintenance of pregnancy. This gene uses two distinct promotors and translation start sites in the first exon to produce several transcript variants, both protein coding and non-protein coding. Two of the isoforms (A and B) are identical except for an additional 165 amino acids found in the N-terminus of isoform B and mediate their own response genes and physiologic effects with little overlap. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (7) represents an alternate first exon, compared to variant 1, resulting in a protein isoform (D) with a shorter N-terminus.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.