TTC19 (NM_001271420) Human Untagged Clone

CAT#: SC330933

TTC19 (untagged) - Homo sapiens tetratricopeptide repeat domain 19 (TTC19), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TTC19
• Synonyms: 2010204O13Rik; MC3DN2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271420, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAAGATGAGCCAGAAGAGGCTGAGTTAATTTTGCATGACGCTCTTCGTCTCGCCTATCAGACTGATA
  ACAAGAAGGCCATCACTTACACTTATGATTTGATGGCCAACTTAGCATTTATACGGGGTCAGCTTGAAAA
  TGCTGAACAACTTTTTAAAGCAACAATGAGTTACCTCCTTGGAGGGGGCATGAAGCAGGAGGACAATGCA
  ATAATTGAAATTTCCCTAAAGCTGGCCAGTATCTATGCTGCGCAGAACAGACAGGAATTTGCTGTTGCTG
  GCTATGAATTCTGCATTTCAACTCTAGAGGAAAAAATTGAAAGAGAAAAGGAATTAGCAGAAGACATTAT
  GTCAGTGGAAGAGAAAGCCAATACCCACCTCCTCTTGGGCATGTGCTTAGACGCCTGTGCTCGCTACCTT
  CTGTTCTCCAAGCAGCCGTCACAGGCACAAAGGATGTATGAAAAAGCTCTGCAGATTTCTGAAGAAATAC
  AAGGAGAAAGACACCCACAGACCATTGTGCTGATGAGTGACCTGGCTACTACCCTGGATGCACAGGGCCG
  CTTTGATGAGGCCTATATTTATATGCAAAGGGCATCAGATCTGGCAAGACAGATAAATCATCCTGAGCTA
  CACATGGTACTCAGTAATCTAGCTGCAGTTTTGATGCACAGAGAACGATATACACAAGCAAAAGAGATCT
  ACCAGGAAGCACTGAAGCAAGCAAAGCTGAAAAAAGATGAAATTTCTGTACAACACATCAGGGAAGAGTT
  GGCTGAGCTGTCAAAGAAAAGTAGACCTTTGACAAATTCTGTCAAGCTCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271420
• ORF Size: 822 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271420.1, NP_001258349.1
• RefSeq Size: 3642
• RefSeq ORF: 822
• Locus ID: 54902
• Gene Summary: This gene encodes a protein with a tetratricopeptide repeat (TPR) domain containing several TPRs of about 34 aa each. These repeats are found in a variety of organisms including bacteria, fungi and plants, and are involved in a variety of functions including protein-protein interactions. This protein is embedded in the inner mitochondrial membrane and is involved in the formation of the mitochondrial respiratory chain III. It has also been suggested that this protein plays a role in cytokinesis. Mutations in this gene cause mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2012]
  Transcript Variant: This variant (2) differs in its 5' UTR and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.