CFAP410 (NM_001271441) Human Untagged Clone
CAT#: SC330935
C21orf2 (untagged) - Homo sapiens chromosome 21 open reading frame 2 (C21orf2), transcript variant 3
"NM_001271441" in other vectors (2)
Product Images
Other products for "CFAP410"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CFAP410 |
Synonyms | C21orf2; LRRC76; RDMS; SMDAX; YF5/A2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001271441, the custom clone sequence may differ by one or more nucleotides
ATGAAGCTGACGCGGAAGATGGTTCTGACCCGGGCCAAGGCCTCGGAGCTGCACAGCGTGCGCAAGCTCA ACTGCTGGGGCAGCCGCCTCACAGATATCTCCATTTGCCAGGAGATGCCCAGCCTGGAGGTGATCACGCT CAGTGTCAACAGCATCTCCACCCTGGAGCCTGTGAGCCGGTGCCAGCGCCTGAGTGAGCTGTACCTGCGG AGGAACCGCATCCCCAGCCTGGCTGAGCTCTTCTACCTGAAGGGGCTGCCGCGTCTGCGGGTGCTGTGGC TGGCCGAGAACCCGTGCTGCGGCACCAGCCCCCACCGCTACCGCATGACCGTGCTGCGCACCCTGCCGCG CCTACAGAAGCTGGACAACCAGGCTGTGACGGAGGAGGAGCTGTCCCGTGCACTGAGTGAGGGAGAGGAG ATCACTGCGGCCCCAGAGAGAGAGGGCACAGGCCACGGCGGCCCCAAGCTATGCTGCACACTGAGCTCCC TCAGCTCCGCTGCTGAGACTGGCCGGGACCCGCTGGACAGCGAGGAGGAGGCAACCGGCGCCCAGGATGA ACGTGGCCTGAAGCCGCCTTCCCGGGGCCAGTTTCCTTCCCTCTCAGCCAGGGATGCCTCGAGCAGCCAC AGGGGCAGGGTGAGTGGCGGGCCGCTAGGGGCCGCGGCTGCCTCTGCCCACTGCACCCACTGCACAGAAA CCGTGGGGAGGGAGCATGGAGCCTCACAGGGCCCCGTGGGGAGGGAGCATGGAGCCTCACAGGGCCTTGA AGAGCTGTGCCCCAGGGGGAGCTGCGTGTGCGGGTCTGTGAATGCGCACACACGTGTAACACGTGCCCCG CACGGAGCCGTCCTGGCCCCTCAGCCTCTCCTGCTGTCCTGGTCTGTGGAATGTGGGCCCGGGCCCTGCT GGGCTGAGGGCAACAGGAGTCACGTGGAAGAGGTGCCACACACGCGTCCACAGGCGGGGCTCCTCTGCTC AGATTCTCCGAGTGTGCCGAACGTCCTGACTGCCATCCTGCTGCTGCTGCGGGAGCTGGATGCAGAGGGG CTGGAGGCCGTGCAGCAGACTGTGGGCAGCCGGCTGCAGGCCCTGCGTGGGGAAGAGGTGCAGGAGCACG CCGAGTGA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001271441 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271441.1, NP_001258370.1 |
RefSeq Size | 2611 bp |
RefSeq ORF | 1128 bp |
Locus ID | 755 |
Cytogenetics | 21q22.3 |
Gene Summary | 'Four alternatively spliced transcript variants encoding four different isoforms have been found for this nuclear gene. All isoforms contain leucine-rich repeats. Three of these isoforms are mitochondrial proteins and one of them lacks the target peptide, so is not located in mitochondrion. This gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. [provided by RefSeq, Sep 2012]' Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The resulting isoform (3) has an additional segment in the C-terminal region, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.