CFAP410 (NM_001271442) Human Untagged Clone

CAT#: SC330936

C21orf2 (untagged) - Homo sapiens chromosome 21 open reading frame 2 (C21orf2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CFAP410
• Synonyms: C21orf2; LRRC76; RDMS; SMDAX; YF5/A2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271442, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCCAGCCTGGAGGTGATCACGCTCAGCATCTCCACCCTGGAGCCTGTGAGCCGGTGCCAGCGCCTGA
  GTGAGCTGTACCTGCGGAGGAACCGCATCCCCAGCCTGGCTGAGCTCTTCTACCTGAAGGGGCTGCCGCG
  TCTGCGGGTGCTGTGGCTGGCCGAGAACCCGTGCTGCGGCACCAGCCCCCACCGCTACCGCATGACCGTG
  CTGCGCACCCTGCCGCGCCTACAGAAGCTGGACAACCAGGCTGTGACGGAGGAGGAGCTGTCCCGTGCAC
  TGAGTGAGGGAGAGGAGATCACTGCGGCCCCAGAGAGAGAGGGCACAGGCCACGGCGGCCCCAAGCTATG
  CTGCACACTGAGCTCCCTCAGCTCCGCTGCTGAGACTGGCCGGGACCCGCTGGACAGCGAGGAGGAGGCA
  ACCGGCGCCCAGGATGAACGTGGCCTGAAGCCGCCTTCCCGGGGCCAGTTTCCTTCCCTCTCAGCCAGGG
  ATGCCTCGAGCAGCCACAGGGGCAGGAACGTCCTGACTGCCATCCTGCTGCTGCTGCGGGAGCTGGATGC
  AGAGGGGCTGGAGGCCGTGCAGCAGACTGTGGGCAGCCGGCTGCAGGCCCTGCGTGGGGAAGAGGTGCAG
  GAGCACGCCGAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271442
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271442.1, NP_001258371.1
• RefSeq Size: 2159 bp
• RefSeq ORF: 645 bp
• Locus ID: 755
• Cytogenetics: 21q22.3
• Gene Summary: 'Four alternatively spliced transcript variants encoding four different isoforms have been found for this nuclear gene. All isoforms contain leucine-rich repeats. Three of these isoforms are mitochondrial proteins and one of them lacks the target peptide, so is not located in mitochondrion. This gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. [provided by RefSeq, Sep 2012]'
  Transcript Variant: This variant (4) has an alternate 5' exon and an additional exon in the 5' region, which cause translation initiation at a downstream AUG, compared to variant 1. The resulting isoform (4, also known as A2) is shorter and lacks a mitochondrial targeting peptide, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.