RQCD1 (CNOT9) (NM_001271635) Human Untagged Clone
CAT#: SC330946
RQCD1 (untagged) - Homo sapiens RCD1 required for cell differentiation1 homolog (S. pombe) (RQCD1), transcript variant 3
"NM_001271635" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CNOT9 |
Synonyms | CAF40; CT129; RCD-1; RCD1; RQCD1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001271635, the custom clone sequence may differ by one or more nucleotides
ATGCACAGCCTGGCGACGGCTGCGCCTGTGCCTACTACACTGGCACAAGTGGATAGAGAAAAGATCTATC AGTGGATCAATGAGCTGTCCAGTCCTGAGACTAGGGAAAATGCTTTGCTGGAGCTAAGTAAGAAGCGAGA ATCTGTTCCTGACCTTGCACCCATGCTGTGGCATTCATTTGGTACTATTGCAGCACTTTTACAGGAAATT GTAAATATTTATCCATCTATCAACCCACCCACCTTGACAGCACACCAGTCTAACAGAGTTTGCAATGCTC TGGCATTACTGCAATGTGTAGCATCACATCCAGAAACCAGGTCAGCGTTTCTCGCAGCACACATCCCACT TTTTTTGTACCCCTTTTTGCACACTGTCAGCAAAACACGTCCCTTTGAGTATCTCCGGCTCACCAGCCTT GGAGTTATTGGGGCCCTGGTGAAAACAGATGAACAAGAAGTAATCAACTTTTTATTAACAACAGAAATTA TCCCTTTATGTTTGCGAATTATGGAATCTGGAAGTGAACTTTCTAAAACAGTTGCCACATTCATCCTCCA GAAGATCTTGTTAGATGACACTGGTTTGGCTTATATATGTCAGACGTATGAGCGTTTCTCCCATGTTGCC ATGATCTTGGGTAAGATGGTCCTGCAGCTATCCAAAGAGCCTTCTGCCCGTCTGCTGAAGCATGTAGTGA GATGTTACCTTCGACTTTCAGATAACCCCAGGTTTTCAGATTTGACTTTCTGCTGGTCATCTTTTCAAAG AAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271635 |
ORF Size | 777 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001271635.1, NP_001258564.1 |
RefSeq Size | 1444 |
RefSeq ORF | 777 |
Locus ID | 9125 |
Protein Pathways | RNA degradation |
Gene Summary | This gene encodes a member of the highly conserved RCD1 protein family. The encoded protein is a transcriptional cofactor and a core protein of the CCR4-NOT complex. It may be involved in signal transduction as well as retinoic acid-regulated cell differentiation and development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2012] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region and includes an alternate terminal exon, compared to variant 1. It encodes isoform 3 which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232306 | RQCD1 (Myc-DDK tagged) - Homo sapiens RCD1 required for cell differentiation1 homolog (S. pombe) (RQCD1), transcript variant 3 |
USD 420.00 |
|
RG232306 | RQCD1 (GFP-tagged) - Homo sapiens RCD1 required for cell differentiation1 homolog (S. pombe) (RQCD1), transcript variant 3 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review