SLC35A3 (NM_001271684) Human Untagged Clone

CAT#: SC330953

SLC35A3 (untagged) - Homo sapiens solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 (SLC35A3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC35A3
• Synonyms: AMRS
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271684, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCGCCAACCTAAAATACGTTTCCCTGGGAATTTTGGTCTTTCAGACTACCAGTTTGGTTCTAACAA
  TGCGTTATTCCAGAACTTTAAAAGAAGAAGGACCTCGTTATCTATCTTCTACAGCAGTGGTTGTTGCTGA
  ACTTTTGAAGATAATGGCCTGCATTTTATTGGTCTACAAAGACAGCAAATGTAGTCTAAGAGCACTGAAT
  CGAGTACTACATGATGAAATTCTTAATAAACCTATGGAAACACTTAAACTTGCTATTCCATCAGGGATCT
  ATACTCTTCAGAATAATTTACTGTATGTGGCACTATCAAATCTAGATGCAGCTACTTATCAGGTCACGTA
  TCAGTTAAAAATTCTTACAACAGCATTATTTTCTGTGTCTATGCTTAGTAAAAAATTGGGTGTATACCAG
  TGGCTGTCCCTAGTAATTTTGATGACAGGAGTTGCTTTTGTACAGTGGCCCTCAGATTCTCAGCTTGATT
  CTAAGGAACTTTCAGCTGGTTCTCAATTTGTAGGACTCATGGCAGTTCTCACAGCATGTTTTTCAAGTGG
  CTTTGCTGGGGTTTACTTTGAGAAAATCTTAAAAGAAACAAAACAATCAGTGTGGATAAGAAATATTCAG
  CTTGTGTCTTTTTCCTTGGAGCCATCCTTGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271684
• ORF Size: 663 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271684.1, NP_001258613.1
• RefSeq Size: 5633
• RefSeq ORF: 663
• Locus ID: 23443
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a UDP-N-acetylglucosamine transporter found in the golgi apparatus membrane. In cattle, a missense mutation in this gene causes complex vertebral malformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
  Transcript Variant: This variant (2) lacks two exons in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.