SLC35A3 (NM_001271685) Human Untagged Clone

CAT#: SC330954

SLC35A3 (untagged) - Homo sapiens solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 (SLC35A3), transcript variant 3


  "NM_001271685" in other vectors (2)

Reconstitution Protocol

USD 370.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC35A3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC35A3
Synonyms AMRS
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271685, the custom clone sequence may differ by one or more nucleotides


ATGAGCTCTCGCTCGGTGTTGAGCCCTGTGGTAGGCACAGATGCACCCGACCAGCACCTGGAGCTCAAGA
AGCCGCAGGAACTTAAAGAAATGGAAAGGCTGCCCTTGGCAAATGAAGATAAAACAATGTTCGCCAACCT
AAAATACGTTTCCCTGGGAATTTTGGTCTTTCAGACTACCAGTTTGGTTCTAACAATGCGTTATTCCAGA
ACTTTAAAAGAAGAAGGACCTCGTTATCTATCTTCTACAGCAGTGGTTGTTGCTGAACTTTTGAAGATAA
TGGCCTGCATTTTATTGGTCTACAAAGACAGCAAATGTAGTCTAAGAGCACTGAATCGAGTACTACATGA
TGAAATTCTTAATAAACCTATGGAAACACTTAAACTTGCTATTCCATCAGGGATCTATACTCTTCAGAAT
AATTTACTGTATGTGGCACTATCAAATCTAGATGCAGCTACTTATCAGGTCACGTATCAGTTAAAAATTC
TTACAACAGCATTATTTTCTGTGTCTATGCTTAGTAAAAAATTGGGTGTATACCAGTGGCTGTCCCTAGT
AATTTTGATGACAGGAGTTGCTTTTGTACAGTGGCCCTCAGATTCTCAGCTTGATTCTAAGGAACTTTCA
GCTGGTTCTCAATTTGTAGGACTCATGGCAGTTCTCACAGCATGTTTTTCAAGTGGCTTTGCTGGGGTTT
ACTTTGAGAAAATCTTAAAAGAAACAAAACAATCAGTGTGGATAAGAAATATTCAGCTTGGTTTCTTTGG
AAGTATATTTGGATTAATGGGTGTATACATTTATGATGGAGAACTGGTATCAAAGAATGGATTTTTTCAG
GGATATAACCGACTGACCTGGATAGTAGTTGTTCTTCAGGCACTTGGAGGCCTTGTAATAGCTGCTGTTA
TTAAGTATGCAGATAATATTTTAAAAGGATTTGCAACCTCTTTATCGATAATATTATCAACATTGATCTC
CTATTTTTGGCTTCAAGATTTTGTGCCAACCAGTGTCTTTTTCCTTGGAGCCATCCTTGTAATAACAGCT
ACTTTTTTGTATGGTTATGATCCCAAACCTGCAGGAAATCCCACTAAAGCATAG


Restriction Sites SgfI-MluI     
ACCN NM_001271685
ORF Size 1104 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_001271685.1, NP_001258614.1
RefSeq Size 5721
RefSeq ORF 1104
Locus ID 23443
Protein Families Transmembrane
Gene Summary This gene encodes a UDP-N-acetylglucosamine transporter found in the golgi apparatus membrane. In cattle, a missense mutation in this gene causes complex vertebral malformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (3) uses an alternate 5' exon structure, which introduces an upstream start codon, compared to variant 1. It encodes isoform 3, which has a longer N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.