GTF2H3 (NM_001271867) Human Untagged Clone
CAT#: SC330987
GTF2H3 (untagged) - Homo sapiens general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3), transcript variant 3
"NM_001271867" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GTF2H3 |
Synonyms | BTF2; P34; TFB4; TFIIH |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001271867, the custom clone sequence may differ by one or more nucleotides
ATGGTGCTGGGAAATTCGCATTTATTCATGAATCGTTCCAACAAACTTGCTGTGATAGCAAGTCACATTC AAGAAAGCCGATTCTTATATCCTGGAAAGAATGGCAGACTTGGAGACTTCTTCGGAGACCCTGGCAACCC TCCTGAATTTAATCCCTCTGGGAGTAAAGATGGAAAATACGAACTTTTAACCTCAGCAAATGAAGTTATT GTTGAAGAGATTAAAGATCTAATGACCAAAAGTGACATAAAGGGTCAACATACAGAAACTTTGCTGGCAG GATCCCTGGCCAAAGCCCTTTGCTACATTCATAGAATGAACAAGGAAGTTAAAGACAATCAGGAAATGAA ATCAAGGATATTGGTGATTAAGGCTGCAGAAGACAGTGCGTTGCAGTATATGAACTTCATGAATGTCATC TTTGCAGCACAGAAACAGAATATTTTGATTGATGCCTGTGTTTTAGACTCCGACTCAGGGCTCCTCCAAC AGGCTTGTGACATCACGGGAGGACTGTACCTGAAGGTGCCTCAGATGCCTTCTCTTCTGCAGTATTTGCT GTGGGTGTTTCTTCCCGATCAAGATCAGAGATCTCAGTTAATCCTCCCACCCCCAGTTCATGTTGACTAC AGGGCTGCTTGCTTCTGTCATCGAAATCTCATTGAAATTGGTTATGTCTGTTCTGTGTGTTTGTCAATAT TCTGCAATTTCAGCCCCATTTGTACTACGTGCGAGACAGCCTTTAAAATTTCTCTGCCTCCAGTGCTGAA AGCCAAGAAAAAGAAACTGAAAGTGTCTGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271867 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271867.1, NP_001258796.1 |
RefSeq Size | 3354 bp |
RefSeq ORF | 804 bp |
Locus ID | 2967 |
Cytogenetics | 12q24.31 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Basal transcription factors, Nucleotide excision repair |
Gene Summary | 'This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012]' Transcript Variant: This variant (3) lacks an exon in the central coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (c) has a shorter N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232334 | GTF2H3 (Myc-DDK tagged) - Homo sapiens general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3), transcript variant 3 |
USD 420.00 |
|
RG232334 | GTF2H3 (GFP-tagged) - Homo sapiens general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3), transcript variant 3 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review