Estrogen Receptor beta (ESR2) (NM_001271877) Human Untagged Clone
CAT#: SC330991
ESR2 (untagged) - Homo sapiens estrogen receptor 2 (ER beta) (ESR2), transcript variant g
"NM_001271877" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "ESR2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ESR2 |
Synonyms | ER-BETA; Erb; ESR-BETA; ESRB; ESTRB; NR3A2; ODG8 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001271877, the custom clone sequence may differ by one or more nucleotides
ATGGATATAAAAAACTCACCATCTAGCCTTAATTCTCCTTCCTCCTACAACTGCAGTCAATCCATCTTAC CCCTGGAGCACGGCTCCATATACATACCTTCCTCCTATGTAGACAGCCACCATGAATATCCAGCCATGAC ATTCTATAGCCCTGCTGTGATGAATTACAGCATTCCCAGCAATGTCACTAACTTGGAAGGTGGGCCTGGT CGGCAGACCACAAGCCCAAATGTGTTGTGGCCAACACCTGGGCACCTTTCTCCTTTAGTGGTCCATCGCC AGTTATCACATCTGTATGCGGAACCTCAAAAGAGTCCCTGGTGTGAAGCAAGATCGCTAGAACACACCTT ACCTGTAAACAGAGAGACACTGAAAAGGAAGGTTAGTGGGAACCGTTGCGCCAGCCCTGTTACTGGTCCA GGTTCAAAGAGGGATGCTCACTTCTGCGCTGTCTGCAGCGATTACGCATCGGGATATCACTATGGAGTCT GGTCGTGTGAAGGATGTAAGGCCTTTTTTAAAAGAAGCATTCAAGGACATAATGATTATATTTGTCCAGC TACAAATCAGTGTACAATCGATAAAAACCGGCGCAAGAGCTGCCAGGCCTGCCGACTTCGGAAGTGTTAC GAAGTGGGAATGGTGAAGTGTGGCTCCCGGAGAGAGAGATGTGGGTACCGCCTTGTGCGGAGACAGAGAA GTGCCGACGAGCAGCTGCACTGTGCCGGCAAGGCCAAGAGAAGTGGCGGCCACGCGCCCCGAGTGCGGGA GCTGCTGCTGGACGCCCTGAGCCCCGAGCAGCTAGTGCTCACCCTCCTGGAGGCTGAGCCGCCCCATGTG CTGATCAGCCGCCCCAGTGCGCCCTTCACCGAGGCCTCCATGATGATGTCCCTGACCAAGTTGGCCGACA AGGAGTTGGTACACATGATCAGCTGGGCCAAGAAGATTCCCGGTATGTACCCTCTGGTCACAGCGACCCA GGATGCTGACAGCAGCCGGAAGCTGGCTCACTTGCTGAACGCCGTGACCGATGCTTTGGTTTGGGTGATT GCCAAGAGCGGCATCTCCTCCCAGCAGCAATCCATGCGCCTGGCTAACCTCCTGATGCTCCTGTCCCACG TCAGGCATGCGAGTAACAAGGGCATGGAACATCTGCTCAACATGAAGTGCAAAAATGTGGTCCCAGTGTA TGACCTGCTGCTGGAGATGCTGAATGCCCACGTGCTTCGCGGGTGCAAGTCCTCCATCACGGGGTCCGAG TGCAGCCCGGCAGAGGACAGTAAAAGCAAAGAGGGCTCCCAGAACCCACAGTCTCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271877 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271877.1, NP_001258806.1 |
RefSeq Size | 1518 bp |
RefSeq ORF | 1320 bp |
Locus ID | 2100 |
Cytogenetics | 14q23.2-q23.3 |
Protein Families | Druggable Genome, Nuclear Hormone Receptor, Transcription Factors |
Gene Summary | 'This gene encodes a member of the family of estrogen receptors and superfamily of nuclear receptor transcription factors. The gene product contains an N-terminal DNA binding domain and C-terminal ligand binding domain and is localized to the nucleus, cytoplasm, and mitochondria. Upon binding to 17beta-estradiol or related ligands, the encoded protein forms homo- or hetero-dimers that interact with specific DNA sequences to activate transcription. Some isoforms dominantly inhibit the activity of other estrogen receptor family members. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been fully characterized. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (g) lacks two consecutive exons in the coding region compared to variant a. The resulting isoform (6, also known as 5/6) lacks an internal segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.