CIB2 (NM_001271888) Human Untagged Clone

CAT#: SC330995

CIB2 (untagged) - Homo sapiens calcium and integrin binding family member 2 (CIB2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CIB2
• Synonyms: DFNB48; KIP2; USH1J
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271888, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACTACAGGAAGAGCCCCATCGTCCACGTGCCCATGAGCCTCATCATCCAGATGCCAGAGCTCCGGG
  AGAATCCCTTCAAAGAAAGGATCGTGGCGGCGTTTTCCGAGGATGGTGAGGGGAACCTCACTTTCAACGA
  CTTTGTGGACATGTTTTCCGTGCTCTGCGAGTCGGCTCCCCGAGAGCTCAAGGCAAACTATGCCTTCAAG
  ATCTATGACTTCAACACTGACAACTTCATCTGCAAGGAGGACCTGGAGCTGACGCTGGCCCGGCTCACTA
  AGTCAGAGCTGGATGAGGAGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCTGACTTGGACGG
  TGACGGCAAGCTGGGCTTTGCTGACTTCGAGGACATGATTGCCAAGGCCCCTGACTTCCTCAGCACTTTC
  CACATCCGGATCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271888
• ORF Size: 435 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271888.1, NP_001258817.1
• RefSeq Size: 1588
• RefSeq ORF: 435
• Locus ID: 10518
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene is similar to that of KIP/CIB, calcineurin B, and calmodulin. The encoded protein is a calcium-binding regulatory protein that interacts with DNA-dependent protein kinase catalytic subunits (DNA-PKcs), and it is involved in photoreceptor cell maintenance. Mutations in this gene cause deafness, autosomal recessive, 48 (DFNB48), and also Usher syndrome 1J (USH1J). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) lacks an alternate exon, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1.