CIB2 (NM_001271889) Human Untagged Clone
CAT#: SC330996
CIB2 (untagged) - Homo sapiens calcium and integrin binding family member 2 (CIB2), transcript variant 3
"NM_001271889" in other vectors (2)
Product Images
Other products for "CIB2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CIB2 |
Synonyms | DFNB48; KIP2; USH1J |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001271889, the custom clone sequence may differ by one or more nucleotides
ATGGGGAACAAGCAGACCATCTTCACCGAAGAGCAGCTAGACAACTACCAGGAGAATCCCTTCAAAGAAA GGATCGTGGCGGCGTTTTCCGAGGATGGTGAGGGGAACCTCACTTTCAACGACTTTGTGGACATGTTTTC CGTGCTCTGCGAGTCGGCTCCCCGAGAGCTCAAGGCAAACTATGCCTTCAAGATCTATGACTTCAACACT GACAACTTCATCTGCAAGGAGGACCTGGAGCTGACGCTGGCCCGGCTCACTAAGTCAGAGCTGGATGAGG AGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCTGACTTGGACGGTGACGGCAAGCTGGGCTT TGCTGACTTCGAGGACATGATTGCCAAGGCCCCTGACTTCCTCAGCACTTTCCACATCCGGATCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271889 |
ORF Size | 417 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001271889.1, NP_001258818.1 |
RefSeq Size | 1476 |
RefSeq ORF | 417 |
Locus ID | 10518 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is similar to that of KIP/CIB, calcineurin B, and calmodulin. The encoded protein is a calcium-binding regulatory protein that interacts with DNA-dependent protein kinase catalytic subunits (DNA-PKcs), and it is involved in photoreceptor cell maintenance. Mutations in this gene cause deafness, autosomal recessive, 48 (DFNB48), and also Usher syndrome 1J (USH1J). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (3) lacks two alternate exons resulting in the loss of an in-frame segment in the 5' coding region, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.