Rab4 (RAB4A) (NM_001271998) Human Untagged Clone

CAT#: SC331020

RAB4A (untagged) - Homo sapiens RAB4A, member RAS oncogene family (RAB4A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAB4A
• Synonyms: HRES-1; HRES-1/RAB4; HRES1; RAB4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271998, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATATCACCAGATGCCCGAATGCTAGCGAGCCAGAACATTGTGATCATCCTTTGTGGAAACAAGAAGG
  ACCTGGATGCAGATCGTGAAGTTACCTTCTTAGAAGCCTCCAGATTTGCTCAAGAAAATGAGCTGATGTT
  TTTGGAAACAAGTGCGCTCACAGGGGAGAATGTAGAAGAGGCTTTTGTACAGTGTGCAAGAAAAATACTT
  AACAAAATCGAATCAGGTGAGCTGGACCCAGAAAGAATGGGCTCAGGTATTCAGTACGGAGATGCTGCCT
  TGAGACAGCTGAGGTCACCGCGGCGCGCACAGGCCCCGAACGCTCAGGAGTGTGGTTGTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271998
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271998.1, NP_001258927.1
• RefSeq Size: 2822 bp
• RefSeq ORF: 342 bp
• Locus ID: 5867
• Cytogenetics: 1q42.13
• Protein Families: Druggable Genome
• Protein Pathways: Endocytosis
• Gene Summary: 'This gene is a member of the largest group in the Ras superfamily of small GTPases, which regulate membrane trafficking. The encoded protein is associated with early endosomes and is involved in their sorting and recycling. The protein also plays a role in regulating the recycling of receptors from endosomes to the plasma membrane. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]'
  Transcript Variant: This variant (2) has multiple differences in the coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.